Polymerase Chain Reaction PDF

POLYMERASE CHAIN REACTION 335 S p e c i f i c S y n t h e s i s o f D N A in Vitro v i a a Polymerase-Catalyzed Chain Reaction By KARY B. MULLIS and FRED A. FALOONA We have devised a method whereby a nucleic...

POLYMERASE CHAIN REACTION 335 S p e c i f i c S y n t h e s i s o f D N A in Vitro v i a a Polymerase-Catalyzed Chain Reaction By KARY B. MULLIS and FRED A. FALOONA We have devised a method whereby a nucleic acid sequence can be exponentially amplified in vitro. The same method can be used to alter the amplified sequence or to append new sequence information to it. It is necessary that the ends of the sequence be known in sufficient detail that oligonucleotides can be synthesized which will hybridize to them, and that a small amount of the sequence be available to initiate the reaction. It is not necessary that the sequence to be synthesized enzymatically be present initially in a pure form; it can be a minor fraction of a complex mixture, such as a segment of a single-copy gene in whole human DNA. The sequence to be synthesized can be present initially as a discrete molecule or it can be part of a larger molecule. In either case, the product of the reaction will be a discrete dsDNA molecule with termini corre- sponding to the 5' ends of the oligomers employed. Synthesis of a 110-bp fragment from a larger molecule via this proce- dure, which we have termed polymerase chain reaction, is depicted in Fig. 1. A source of DNA including the desired sequence is denatured in the presence of a large molar excess of two oligonucleotides and the four deoxyribonucleoside triphosphates. The oligonucleotides are comple- mentary to different strands of the desired sequence and at relative posi- tions along the sequence such that the DNA polymerase extension prod- uct of the one, when denatured, can serve as a template for the other, and vice versa. DNA polymerase is added and a reaction allowed to occur. The reaction products are denatured and the process is repeated until the desired amount of the l l0-bp sequence bounded by the two oligonu- cleotides is obtained. During the first and each subsequent reaction cycle extension of each oligonucleotide on the original template will produce one new ssDNA molecule of indefinite length. These "long products" will accumulate in a linear fashion, i.e., the amount present after any number of cycles will be linearly proportional to the number of cycles. The long products thus produced will act as templates for one or the other of the oligonucleotides during subsequent cycles and extension of these oligonucleotides by poly- merase will produce molecules of a specific length, in this case, 110 bases long. These will also function as templates for one or the other of the oligonucleotides producing more 110-base molecules. Thus a chain reac- Copyright © 1987 by Academic Press, Inc. METHODS IN ENZYMOLOGY, VOL. 155 All rights of reproduction in any form reserved.  !.................................... ll0-bp.......................................... I 3'-PC04 ZXTZNDSEXTEND$ 3,-FCO3 J Polymecame + CYCLE 1 dWTPe --'-.................. TGTGTTG&CACAAGTGATCG............. "''-............................... ccacttgcacctacttcaac ~ ; ~ J ~ ] ~ k ~ i ~ ~ 1 ~ H ~ j ~ f ~ I ~ I i ~ H -'-................... ACACAACTGTGTTCACTAGC............. '''-............................... GGTGAACGTGGATGAAGTTG............... "-- -''-.................. TGTGTTGACACJEAGTGATCG............. "''-............................... CCACTTGCACCTACTTCAAC............... --- ~ i ~ i ~ ~ i ~ ~ H ~ i ~ H ~ acacaactgtgttcactag©............. "''-............................... GGTGAACGTGGATGAAGTTG............... --- Oenature, ~ n u l "''-.................. ~G~TTGACACRAOTG&TCGT-........... "''-............................... ccacttqcacctacttcaac l l l l l i l l l l l l l l l l l l l l acICn©tgtgttcactagc---->EXT~NDS 3'-~04 3'-!~03 EXTENDSExTE~DS 3'-~C04 3'-PC03 EXTE~DS