Molecular Biology & DNA Structure

Choose a study mode

Play Quiz
Study Flashcards
Spaced Repetition
Chat to Lesson

Podcast

Play an AI-generated podcast conversation about this lesson
Download our mobile app to listen on the go
Get App

Questions and Answers

What is the primary function of DNA in all living organisms?

  • To transport nutrients throughout the organism.
  • To provide quick energy for cellular processes.
  • To protect the cell from external pathogens and toxins.
  • To serve as the universal code containing instructions for building and maintaining cells. (correct)

Which of the following best describes the role of molecular biology in understanding DNA?

  • It focuses on observing the external characteristics of organisms.
  • It investigates life at the level of individual molecules, including DNA. (correct)
  • It studies the interactions between different species in an ecosystem.
  • It aims to classify organisms based on their evolutionary history.

What is the significance of the discovery of the chemical structure of DNA by James Watson and Francis Crick?

  • It had no impact on the field of biology.
  • It confirmed the existing theories of genetics and heredity.
  • It led to a decrease in the study of genetics.
  • It opened a new era in biology by elucidating fundamental processes in genetics. (correct)

What are the three components of a nucleotide?

<p>A sugar, a phosphate group, and a base. (A)</p> Signup and view all the answers

Which of the following base pairings is correct in a DNA molecule?

<p>Adenine (A) pairs with Thymine (T). (A)</p> Signup and view all the answers

What is the structural arrangement of DNA commonly referred to as?

<p>Double helix. (B)</p> Signup and view all the answers

What does it mean when the two strands of DNA are described as 'anti-parallel'?

<p>The strands are mirror images and run in opposite directions. (D)</p> Signup and view all the answers

In humans, how many unique pairs of chromosomes are typically found?

<p>23 (B)</p> Signup and view all the answers

What is the complete set of DNA in an organism referred to as?

<p>Genome (B)</p> Signup and view all the answers

What is a gene?

<p>A DNA sequence that codes for a specific trait. (A)</p> Signup and view all the answers

Approximately what percentage of the DNA base code is translated into proteins?

<p>2% (D)</p> Signup and view all the answers

What are alleles?

<p>Different versions of the same gene. (A)</p> Signup and view all the answers

If 'A' represents a dominant allele for a particular trait, what is observed if an organism has this allele?

<p>The trait associated with the dominant allele will be expressed. (A)</p> Signup and view all the answers

What is the difference between genotype and phenotype?

<p>Genotype is the genetic makeup, while phenotype is the physical manifestation of traits. (C)</p> Signup and view all the answers

What is the primary purpose of DNA replication?

<p>To produce new cells for growth and reproduction. (D)</p> Signup and view all the answers

During DNA replication, what role does each strand of the original DNA molecule play?

<p>Each strand serves as a template for the synthesis of a new, complementary strand. (D)</p> Signup and view all the answers

What is meant by 'semi-conservative' replication of DNA?

<p>The new DNA molecule consists of one original strand and one newly synthesized strand. (B)</p> Signup and view all the answers

In DNA replication, which nucleotide bases correctly pair up?

<p>A-T and C-G (C)</p> Signup and view all the answers

During DNA replication, what is the role of parent strands?

<p>They each serve as a template. (A)</p> Signup and view all the answers

After DNA replication, what are the components of the resulting double helix?

<p>One parent strand and one daughter strand. (B)</p> Signup and view all the answers

What is the purpose of DNA polymerase during DNA replication?

<p>To bind free nucleotides and bind fragments. (A)</p> Signup and view all the answers

In the context of Labrador Retriever coat color, what does it mean for the yellow coat allele to be 'epistatic'?

<p>Yellow can mask the expression of black or brown, regardless of their alleles. (B)</p> Signup and view all the answers

A scientist is studying a new organism and observes that its cells contain 1,260 chromosomes. Based on this information, which organism is the scientist most likely studying?

<p>Adders-tongue fern (B)</p> Signup and view all the answers

A diploid cell has chromosomes that come in pairs. If '2n' represents the diploid number, and a certain organism has a 2n number of 8, how many chromosomes would be present in its gametes (sex cells)?

<p>4 (B)</p> Signup and view all the answers

Given the DNA sequence TTGTTATCCGCTCACAATTCCACACAAC, which of the following sequences is the complementary strand produced during replication?

<p><code>AACGATAAGGCGUCGUGTTAAGGTGTGTGG</code> (D)</p> Signup and view all the answers

A scientist discovers a new gene in mice that seems to control tail length. Some mice have long tails, while others have short tails. She identifies three different versions of the gene (alleles). If these alleles follow a simple dominant/recessive pattern and short tails are only observed when a mouse has two copies of the recessive allele, what can you conclude?

<p>Long tails must be the dominant trait. (C)</p> Signup and view all the answers

Imagine a scenario where a scientist is studying a particular gene that codes for an important metabolic enzyme. They discover that a certain allele of this gene results in a non-functional enzyme. Individuals with one copy of the functional allele and one copy of the non-functional allele produce approximately half the normal amount of the enzyme. Based on this, which of the following mechanisms is MOST likely at play?

<p>The functional allele is haploinsufficient; one copy does not provide enough enzyme for normal function. (B)</p> Signup and view all the answers

A researcher is studying the process of DNA replication in a novel bacterial species. They discover a mutant strain with a significantly reduced replication rate due to a deficiency in unwinding the DNA double helix. Which specific enzyme is most likely affected?

<p>Helicase (C)</p> Signup and view all the answers

Flashcards

DNA

The universal code for all life on earth, providing instructions for building and maintaining cells.

DNA: Instructions

Instructions for an organism: Body, growth and development (1) passed from parent to offspring (2).

Molecular biology

Investigation of life at the level of individual molecules.

Nucleotides

Building blocks of DNA, each consisting of a sugar, phosphate group, and a base.

Signup and view all the flashcards

DNA structure

The twisted ladder shape of DNA, formed by two strands of nucleotides.

Signup and view all the flashcards

Genome

Complete set of DNA in an organism

Signup and view all the flashcards

Chromosome

Unique linear nucleic acids (DNA), Humans have 23 unique pairs.

Signup and view all the flashcards

Gene

A DNA sequence.

Signup and view all the flashcards

Alleles

Different versions of the same gene

Signup and view all the flashcards

Genotype

The genetic makeup of an organism.

Signup and view all the flashcards

Phenotype

Physical manifestations of Allelic interactions.

Signup and view all the flashcards

DNA Replication

The process of creating new cells for growth and reproduction.

Signup and view all the flashcards

DNA Replication

Each strand is template for synthesis of a new, complementary strand.

Signup and view all the flashcards

DNA Polymerases

Enzymes that are central to DNA replication that unwind DNA, bind free nucleotides, binds fragments and repair.

Signup and view all the flashcards

Study Notes

  • DNA is the universal code for all life on Earth
  • DNA provides instructions for building and maintaining cells
  • It contains instructions for an organism's body, growth, and development
  • Genetic information is passed from parent to offspring via DNA
  • Humans have 23 unique pairs of chromosomes

Rise of Molecular Biology

  • Scientists deciphering DNA structure were working in molecular biology
  • Molecular biology investigates life at the level of individual molecules
  • James Watson and Francis Crick discovered DNA's chemical structure in 1953
  • Their discovery ushered in a new era in biology
  • The new era helped to elucidate fundamental processes in genetics
  • Rosalind Franklin created an X-ray diffraction photograph of DNA
  • Crick and Watson published their findings on DNA structure in 1953 in Cambridge, UK

Structure of DNA

  • DNA molecules comprise building blocks called nucleotides
  • Nucleotides consist of a sugar, a phosphate group, and a base
  • DNA has four types of bases: adenine, guanine, thymine, or cytosine (A, G, T, or C)
  • Sugar and phosphate form the backbone of DNA
  • Nitrogenous bases (A-T, C-G) form the genetic code
  • DNA's structure is that of a twisted ladder or double helix

Genome, Chromosome, Gene

  • A genome is the complete set of DNA in an organism
  • Chromosomes consist of unique linear nucleic acids (DNA)
  • Complete sets of DNA are organized into chromosomes
  • Humans have 23 unique pairs of chromosomes
  • A gene is a DNA sequence (e.g., ATCGGTACTG...)
  • Genes are sections of the DNA base code
  • About 2% of DNA code is translated into proteins
  • DNA can also control expression

Alleles

  • Alleles are different versions of the same gene
  • They code for the same trait
  • A dominant allele expresses its trait if present
  • A recessive allele expresses its trait only if two copies are present
  • Coat color in Labrador Retrievers is controlled by two sets of alleles
  • Black coat color is dominant to brown.
  • Yellow coat color is epistatic, expressed independently of black or brown when two yellow alleles present
  • Genotype refers to the alleles an organism has
  • Phenotype refers to the physical manifestations of allelic interactions

DNA Replication

  • DNA replication is how new cells are made for growth and reproduction
  • DNA is double-stranded, and each strand serves as a template for synthesizing a new, complementary strand
  • DNA Replication is semi-conservative
  • The DNA double helix divides down the middle in replication
  • Nucleotide bases match up: A with T, and C with G
  • Each strand separates and serves as a template
  • Results in two identical strands of DNA
  • Each copied double helix has one parent (original) strand and one daughter (new, complementary) strand

DNA Polymerases

  • DNA polymerases are enzymes central to DNA replication
  • They unwind DNA, bind free nucleotides, bind fragments, and repair DNA

Studying That Suits You

Use AI to generate personalized quizzes and flashcards to suit your learning preferences.

Quiz Team

Related Documents

More Like This

Estructura del ADN y Cromosomas
10 questions
Chromosomes: DNA Structure
6 questions
Chromosomes and DNA Structure
14 questions
DNA and Chromosome Structure
10 questions

DNA and Chromosome Structure

SelfSufficientObsidian6209 avatar
SelfSufficientObsidian6209
Use Quizgecko on...
Browser
Browser