Podcast
Questions and Answers
What type of genetic material does mitochondria have?
What type of genetic material does mitochondria have?
- RNA
- Circular double stranded DNA (correct)
- Linear DNA
- Single stranded DNA
Which process do mitochondria use to generate ATP?
Which process do mitochondria use to generate ATP?
- Oxidative phosphorylation (correct)
- Glycolysis
- Photosynthesis
- Fermentation
How many genes code for 2 ribosomal RNAs in mitochondria?
How many genes code for 2 ribosomal RNAs in mitochondria?
- 22
- 13
- 2
- 37 (correct)
What is the main function of mitochondria in the cell?
What is the main function of mitochondria in the cell?
How do mitochondria divide?
How do mitochondria divide?
What is the approximate length of mitochondrial DNA?
What is the approximate length of mitochondrial DNA?
What are the two types of DNA found in our cells?
What are the two types of DNA found in our cells?
Which type of DNA is located outside the cell nucleus?
Which type of DNA is located outside the cell nucleus?
What is one of the key learning outcomes related to mitochondrial DNA mentioned in the text?
What is one of the key learning outcomes related to mitochondrial DNA mentioned in the text?
Where is the material about Mitochondrial DNA being reproduced from according to the text?
Where is the material about Mitochondrial DNA being reproduced from according to the text?
Which Act is mentioned in relation to copyright in the text?
Which Act is mentioned in relation to copyright in the text?
What is one common feature between mitochondrial and nuclear DNA?
What is one common feature between mitochondrial and nuclear DNA?
What is the purpose of the text provided?
What is the purpose of the text provided?
What does the phrase 'subject to copyright' imply?
What does the phrase 'subject to copyright' imply?
In what context is the 3’ TCCGATCGATTGACAGTGGACTGCATGGATCTGGTACTCATGAACTTAAGCGGTAACTG 5’ repeated?
In what context is the 3’ TCCGATCGATTGACAGTGGACTGCATGGATCTGGTACTCATGAACTTAAGCGGTAACTG 5’ repeated?
What could happen if someone reproduces the material without authorization?
What could happen if someone reproduces the material without authorization?
Based on the text, what is the importance of section 113P of the Copyright Act 1968?
Based on the text, what is the importance of section 113P of the Copyright Act 1968?
What is the main implication of stating 'may be subject to copyright'?
What is the main implication of stating 'may be subject to copyright'?
What is the complementary DNA sequence to 5’ AGGCTAGCTAACTGTCACCTGAC 3’?
What is the complementary DNA sequence to 5’ AGGCTAGCTAACTGTCACCTGAC 3’?
What is the length of the RNA sequence provided?
What is the length of the RNA sequence provided?
Which part of the text indicates that the material is being reproduced by or on behalf of Flinders University?
Which part of the text indicates that the material is being reproduced by or on behalf of Flinders University?
What does the statement '...may be subject to copyright under the Act' imply?
What does the statement '...may be subject to copyright under the Act' imply?
How many nucleotides are involved in the DNA sequence starting with 5’ AGGCTAGCTAACTGTCAC 3’?
How many nucleotides are involved in the DNA sequence starting with 5’ AGGCTAGCTAACTGTCAC 3’?
What is the reason for providing both the 5’ and 3’ DNA sequences?
What is the reason for providing both the 5’ and 3’ DNA sequences?
What is the focus of the video on Sanger sequencing?
What is the focus of the video on Sanger sequencing?
Why is it important to understand the principles of PCR and Sanger sequencing?
Why is it important to understand the principles of PCR and Sanger sequencing?
Which law is mentioned in relation to the copyright protection of the material discussed?
Which law is mentioned in relation to the copyright protection of the material discussed?
What process does Sanger sequencing help in that involves determining the order of nucleotides in a DNA strand?
What process does Sanger sequencing help in that involves determining the order of nucleotides in a DNA strand?
What might be a consequence if there is unauthorized reproduction or communication of the material mentioned?
What might be a consequence if there is unauthorized reproduction or communication of the material mentioned?
Which technique is NOT mentioned as part of understanding Sanger sequencing?
Which technique is NOT mentioned as part of understanding Sanger sequencing?
Flashcards are hidden until you start studying