Mitochondrial DNA Overview

Choose a study mode

Play Quiz
Study Flashcards
Spaced Repetition
Chat to Lesson

Podcast

Play an AI-generated podcast conversation about this lesson
Download our mobile app to listen on the go
Get App

Questions and Answers

What type of genetic material does mitochondria have?

  • RNA
  • Circular double stranded DNA (correct)
  • Linear DNA
  • Single stranded DNA

Which process do mitochondria use to generate ATP?

  • Oxidative phosphorylation (correct)
  • Glycolysis
  • Photosynthesis
  • Fermentation

How many genes code for 2 ribosomal RNAs in mitochondria?

  • 22
  • 13
  • 2
  • 37 (correct)

What is the main function of mitochondria in the cell?

<p>Generating ATP (B)</p> Signup and view all the answers

How do mitochondria divide?

<p>When they need to, regardless of the cell cycle (A)</p> Signup and view all the answers

What is the approximate length of mitochondrial DNA?

<p>16,500 kb (A)</p> Signup and view all the answers

What are the two types of DNA found in our cells?

<p>Nuclear DNA and mitochondrial DNA (A)</p> Signup and view all the answers

Which type of DNA is located outside the cell nucleus?

<p>Mitochondrial DNA (B)</p> Signup and view all the answers

What is one of the key learning outcomes related to mitochondrial DNA mentioned in the text?

<p>Describing differences between mitochondrial and nuclear DNA (A)</p> Signup and view all the answers

Where is the material about Mitochondrial DNA being reproduced from according to the text?

<p>Flinders University (A)</p> Signup and view all the answers

Which Act is mentioned in relation to copyright in the text?

<p>Copyright Act of 1968 (A)</p> Signup and view all the answers

What is one common feature between mitochondrial and nuclear DNA?

<p>Both encode proteins (D)</p> Signup and view all the answers

What is the purpose of the text provided?

<p>To warn against unauthorized reproduction of material (A)</p> Signup and view all the answers

What does the phrase 'subject to copyright' imply?

<p>The material may be protected by law (C)</p> Signup and view all the answers

In what context is the 3’ TCCGATCGATTGACAGTGGACTGCATGGATCTGGTACTCATGAACTTAAGCGGTAACTG 5’ repeated?

<p>As part of a DNA sequence (C)</p> Signup and view all the answers

What could happen if someone reproduces the material without authorization?

<p>They could face legal consequences (A)</p> Signup and view all the answers

Based on the text, what is the importance of section 113P of the Copyright Act 1968?

<p>To allow educational institutions to share material legally (C)</p> Signup and view all the answers

What is the main implication of stating 'may be subject to copyright'?

<p>Copyright protection is not guaranteed (A)</p> Signup and view all the answers

What is the complementary DNA sequence to 5’ AGGCTAGCTAACTGTCACCTGAC 3’?

<p>3’ TCCGATCGATTGACAGTGGACTGCATGGATCTGGTACTCATGAACTTAAGCGGTAACTG 5’ (D)</p> Signup and view all the answers

What is the length of the RNA sequence provided?

<p>75 bases (C)</p> Signup and view all the answers

Which part of the text indicates that the material is being reproduced by or on behalf of Flinders University?

<p>This material has been reproduced and communicated to you by or on behalf of Flinders University... (A)</p> Signup and view all the answers

What does the statement '...may be subject to copyright under the Act' imply?

<p>The material is definitely copyrighted. (D)</p> Signup and view all the answers

How many nucleotides are involved in the DNA sequence starting with 5’ AGGCTAGCTAACTGTCAC 3’?

<p>21 nucleotides (C)</p> Signup and view all the answers

What is the reason for providing both the 5’ and 3’ DNA sequences?

<p>To display complementary base pairing (C)</p> Signup and view all the answers

What is the focus of the video on Sanger sequencing?

<p>Discussing the technical aspect of Sanger sequencing (D)</p> Signup and view all the answers

Why is it important to understand the principles of PCR and Sanger sequencing?

<p>To determine the sequence of DNA accurately (B)</p> Signup and view all the answers

Which law is mentioned in relation to the copyright protection of the material discussed?

<p>Copyright Act of 1968 (B)</p> Signup and view all the answers

What process does Sanger sequencing help in that involves determining the order of nucleotides in a DNA strand?

<p>DNA sequencing (C)</p> Signup and view all the answers

What might be a consequence if there is unauthorized reproduction or communication of the material mentioned?

<p>Infringement leading to legal consequences (B)</p> Signup and view all the answers

Which technique is NOT mentioned as part of understanding Sanger sequencing?

<p>Isolation of proteins (D)</p> Signup and view all the answers

Flashcards are hidden until you start studying

More Like This

Use Quizgecko on...
Browser
Browser