Mitochondrial DNA Overview
30 Questions
1 Views

Choose a study mode

Play Quiz
Study Flashcards
Spaced Repetition
Chat to lesson

Podcast

Play an AI-generated podcast conversation about this lesson

Questions and Answers

What type of genetic material does mitochondria have?

  • RNA
  • Circular double stranded DNA (correct)
  • Linear DNA
  • Single stranded DNA

    • Which process do mitochondria use to generate ATP?

  • Oxidative phosphorylation (correct)
  • Glycolysis
  • Photosynthesis
  • Fermentation

    • How many genes code for 2 ribosomal RNAs in mitochondria?

  • 22
  • 13
  • 2
  • 37 (correct)

    • What is the main function of mitochondria in the cell?

    <p>Generating ATP</p> Signup and view all the answers

    How do mitochondria divide?

    <p>When they need to, regardless of the cell cycle</p> Signup and view all the answers

    What is the approximate length of mitochondrial DNA?

    <p>16,500 kb</p> Signup and view all the answers

    What are the two types of DNA found in our cells?

    <p>Nuclear DNA and mitochondrial DNA</p> Signup and view all the answers

    Which type of DNA is located outside the cell nucleus?

    <p>Mitochondrial DNA</p> Signup and view all the answers

    What is one of the key learning outcomes related to mitochondrial DNA mentioned in the text?

    <p>Describing differences between mitochondrial and nuclear DNA</p> Signup and view all the answers

    Where is the material about Mitochondrial DNA being reproduced from according to the text?

    <p>Flinders University</p> Signup and view all the answers

    Which Act is mentioned in relation to copyright in the text?

    <p>Copyright Act of 1968</p> Signup and view all the answers

    What is one common feature between mitochondrial and nuclear DNA?

    <p>Both encode proteins</p> Signup and view all the answers

    What is the purpose of the text provided?

    <p>To warn against unauthorized reproduction of material</p> Signup and view all the answers

    What does the phrase 'subject to copyright' imply?

    <p>The material may be protected by law</p> Signup and view all the answers

    In what context is the 3’ TCCGATCGATTGACAGTGGACTGCATGGATCTGGTACTCATGAACTTAAGCGGTAACTG 5’ repeated?

    <p>As part of a DNA sequence</p> Signup and view all the answers

    What could happen if someone reproduces the material without authorization?

    <p>They could face legal consequences</p> Signup and view all the answers

    Based on the text, what is the importance of section 113P of the Copyright Act 1968?

    <p>To allow educational institutions to share material legally</p> Signup and view all the answers

    What is the main implication of stating 'may be subject to copyright'?

    <p>Copyright protection is not guaranteed</p> Signup and view all the answers

    What is the complementary DNA sequence to 5’ AGGCTAGCTAACTGTCACCTGAC 3’?

    <p>3’ TCCGATCGATTGACAGTGGACTGCATGGATCTGGTACTCATGAACTTAAGCGGTAACTG 5’</p> Signup and view all the answers

    What is the length of the RNA sequence provided?

    <p>75 bases</p> Signup and view all the answers

    Which part of the text indicates that the material is being reproduced by or on behalf of Flinders University?

    <p>This material has been reproduced and communicated to you by or on behalf of Flinders University...</p> Signup and view all the answers

    What does the statement '...may be subject to copyright under the Act' imply?

    <p>The material is definitely copyrighted.</p> Signup and view all the answers

    How many nucleotides are involved in the DNA sequence starting with 5’ AGGCTAGCTAACTGTCAC 3’?

    <p>21 nucleotides</p> Signup and view all the answers

    What is the reason for providing both the 5’ and 3’ DNA sequences?

    <p>To display complementary base pairing</p> Signup and view all the answers

    What is the focus of the video on Sanger sequencing?

    <p>Discussing the technical aspect of Sanger sequencing</p> Signup and view all the answers

    Why is it important to understand the principles of PCR and Sanger sequencing?

    <p>To determine the sequence of DNA accurately</p> Signup and view all the answers

    Which law is mentioned in relation to the copyright protection of the material discussed?

    <p>Copyright Act of 1968</p> Signup and view all the answers

    What process does Sanger sequencing help in that involves determining the order of nucleotides in a DNA strand?

    <p>DNA sequencing</p> Signup and view all the answers

    What might be a consequence if there is unauthorized reproduction or communication of the material mentioned?

    <p>Infringement leading to legal consequences</p> Signup and view all the answers

    Which technique is NOT mentioned as part of understanding Sanger sequencing?

    <p>Isolation of proteins</p> Signup and view all the answers

    More Like This

    Use Quizgecko on...
    Browser
    Open
    Browser
    Browser