Podcast
Questions and Answers
Explain how analyzing DNA can be useful in identifying species when morphological characteristics are similar.
Explain how analyzing DNA can be useful in identifying species when morphological characteristics are similar.
DNA analysis can identify species even when they look alike because it focuses on the genetic differences that might not be visible in their physical traits.
Describe the role of 'primers' in the Polymerase Chain Reaction (PCR) process and why they are essential.
Describe the role of 'primers' in the Polymerase Chain Reaction (PCR) process and why they are essential.
Primers are short DNA sequences that bind to the beginning of the target DNA segment, signaling the DNA polymerase where to begin copying the DNA. Without primers there is no strand for the polymerase to attach to.
Explain what is meant by the term 'DNA barcoding', and why is the CO1 gene commonly used for this procedure.
Explain what is meant by the term 'DNA barcoding', and why is the CO1 gene commonly used for this procedure.
DNA barcoding is a method of identifying species using short, standardized genetic regions. The CO1 gene is often used because it is found in most eukaryotes and has sufficient variability between species, while it is conserved within a species.
Outline the steps required prior to PCR to access the desired genetic material.
Outline the steps required prior to PCR to access the desired genetic material.
Explain how ice-cold ethanol aids in DNA extraction during the lab procedure.
Explain how ice-cold ethanol aids in DNA extraction during the lab procedure.
Suggest why it's important to remove the supernatant after each centrifugation step in the DNA extraction protocol.
Suggest why it's important to remove the supernatant after each centrifugation step in the DNA extraction protocol.
Explain how gel electrophoresis separates DNA fragments, and why is this separation important for analyzing PCR products?
Explain how gel electrophoresis separates DNA fragments, and why is this separation important for analyzing PCR products?
Describe why, after gel electrophoresis, smaller DNA fragments travel further than larger fragments.
Describe why, after gel electrophoresis, smaller DNA fragments travel further than larger fragments.
Explain how UV light helps to visualize DNA bands in agarose gel electrophoresis.
Explain how UV light helps to visualize DNA bands in agarose gel electrophoresis.
Briefly outline the steps involved in preparing an agarose gel for electrophoresis.
Briefly outline the steps involved in preparing an agarose gel for electrophoresis.
What is the purpose of adding a 'ladder' or DNA marker to an electrophoresis gel?
What is the purpose of adding a 'ladder' or DNA marker to an electrophoresis gel?
Give reasons as to why we might not load the same quantity of DNA in each well when undertaking gel electrophoresis.
Give reasons as to why we might not load the same quantity of DNA in each well when undertaking gel electrophoresis.
Explain why it is important that the taq polymerase isn't a human polymerase.
Explain why it is important that the taq polymerase isn't a human polymerase.
Describe the purpose and function of dideoxynucleotides in the Sanger sequencing method.
Describe the purpose and function of dideoxynucleotides in the Sanger sequencing method.
What is the significance of the 3'-hydroxyl group that is missing in dideoxynucleotides?
What is the significance of the 3'-hydroxyl group that is missing in dideoxynucleotides?
Briefly explain the roles of BLAST and BOLD in DNA barcoding and species identification.
Briefly explain the roles of BLAST and BOLD in DNA barcoding and species identification.
Explain what a 'phylogenetic tree' represents, and how it is constructed using genetic data.
Explain what a 'phylogenetic tree' represents, and how it is constructed using genetic data.
Explain what 'polytomy' mean on a phylogenic tree and what may give rise to such a structure.
Explain what 'polytomy' mean on a phylogenic tree and what may give rise to such a structure.
State in what ways data would be unreliable from a study looking at the relationship between organisms using degradation of DNA.
State in what ways data would be unreliable from a study looking at the relationship between organisms using degradation of DNA.
Suggest why mitochondrial DNA is more effective when looking at genetic diversity and what differences there may be when compared to nuclear DNA.
Suggest why mitochondrial DNA is more effective when looking at genetic diversity and what differences there may be when compared to nuclear DNA.
Explain how the concentration of agarose in a gel affects DNA fragment separation during electrophoresis.
Explain how the concentration of agarose in a gel affects DNA fragment separation during electrophoresis.
Outline the steps you would take to load diluted DNA into a well that's within an agarose gel submerged in TAE buffer.
Outline the steps you would take to load diluted DNA into a well that's within an agarose gel submerged in TAE buffer.
Explain why it's important to use controls in PCR and gel electrophoresis experiments.
Explain why it's important to use controls in PCR and gel electrophoresis experiments.
Suggest 2 hazards that may occur during the process of PCR and precautions that may be implemented.
Suggest 2 hazards that may occur during the process of PCR and precautions that may be implemented.
Provide an example of ethical considerations surrounding the use of DNA barcoding in wildlife conservation.
Provide an example of ethical considerations surrounding the use of DNA barcoding in wildlife conservation.
Describe the effect of using a universal primer pairs not suited to a specific sample undergoing gel electrophoresis.
Describe the effect of using a universal primer pairs not suited to a specific sample undergoing gel electrophoresis.
Name the four deoxynucleotides (dNTPs) needed for DNA synthesis during PCR. Why are all four necessary?
Name the four deoxynucleotides (dNTPs) needed for DNA synthesis during PCR. Why are all four necessary?
Why is a heating step involved in the PCR cycle and what does it do.
Why is a heating step involved in the PCR cycle and what does it do.
When you are taking a sample from the 'target' DNA to be amplified, what requirements must there be.
When you are taking a sample from the 'target' DNA to be amplified, what requirements must there be.
Provide the chemical component of proteinase K that allows it to break down proteins effectively and why is it important to remove these prior to the PCR.
Provide the chemical component of proteinase K that allows it to break down proteins effectively and why is it important to remove these prior to the PCR.
Describe where there should be a bright band when viewing the DNA under a UV light once PCR is complete and the gel has undergone electrophoresis.
Describe where there should be a bright band when viewing the DNA under a UV light once PCR is complete and the gel has undergone electrophoresis.
During a practical there was smearing in a band during gel electrophoresis. What are examples of the potential reasons in why this may be the case?
During a practical there was smearing in a band during gel electrophoresis. What are examples of the potential reasons in why this may be the case?
When the DNA is added to salt why is it that it comes insoluble?
When the DNA is added to salt why is it that it comes insoluble?
Relate the findings from each practical: Firstly extraction, the gel production before and after PCR and then where can this information be used to analyse shark relationships and biodiversity to then manage the waters.
Relate the findings from each practical: Firstly extraction, the gel production before and after PCR and then where can this information be used to analyse shark relationships and biodiversity to then manage the waters.
Briefly describe why, after performing gel electrophoresis, the smearing and small fragments are not what we're interested in.
Briefly describe why, after performing gel electrophoresis, the smearing and small fragments are not what we're interested in.
Outline how we know the polymerase works through heating and cooling?
Outline how we know the polymerase works through heating and cooling?
When loading your gel, what aspects make it successful?
When loading your gel, what aspects make it successful?
From Figure 1 in the workbook, what is occurring in step 1 and why is this required?
From Figure 1 in the workbook, what is occurring in step 1 and why is this required?
Describe why the Barcode of Life if considered a CO1 gene as CO1 may be useful in solving evolutionary links.
Describe why the Barcode of Life if considered a CO1 gene as CO1 may be useful in solving evolutionary links.
Describe the purpose of magnesium cholride after it's relation to PCR.
Describe the purpose of magnesium cholride after it's relation to PCR.
Flashcards
Scientific Investigation
Scientific Investigation
Questions and hypotheses for scientific investigation are developed and evaluated.
Data selection
Data selection
It involves selecting and processing qualitative and quantitative data and information appropriately.
Problem solving
Problem solving
Scientific problems are solved using primary and secondary data with critical thinking.
Communicate science
Communicate science
Signup and view all the flashcards
Explaining Genetic Change
Explaining Genetic Change
Signup and view all the flashcards
Wet-lab workbook
Wet-lab workbook
Signup and view all the flashcards
Module 5 Objective
Module 5 Objective
Signup and view all the flashcards
Wet-lab objective
Wet-lab objective
Signup and view all the flashcards
Module 6 Objective
Module 6 Objective
Signup and view all the flashcards
Agarose Gel
Agarose Gel
Signup and view all the flashcards
Amplification
Amplification
Signup and view all the flashcards
Annealing Definition
Annealing Definition
Signup and view all the flashcards
Centrifuge
Centrifuge
Signup and view all the flashcards
Chain termination
Chain termination
Signup and view all the flashcards
Conservation
Conservation
Signup and view all the flashcards
CO1 gene
CO1 gene
Signup and view all the flashcards
Cryptic species
Cryptic species
Signup and view all the flashcards
Denaturation
Denaturation
Signup and view all the flashcards
Dideoxynucleotides
Dideoxynucleotides
Signup and view all the flashcards
Dilute
Dilute
Signup and view all the flashcards
DNA barcoding
DNA barcoding
Signup and view all the flashcards
Taq polymerase
Taq polymerase
Signup and view all the flashcards
Elongation
Elongation
Signup and view all the flashcards
Endangered
Endangered
Signup and view all the flashcards
Gel electrophoresis
Gel electrophoresis
Signup and view all the flashcards
Genome
Genome
Signup and view all the flashcards
Lineage
Lineage
Signup and view all the flashcards
Denaturation stage
Denaturation stage
Signup and view all the flashcards
Cells for DNA
Cells for DNA
Signup and view all the flashcards
What are primers?
What are primers?
Signup and view all the flashcards
Nucleotide bases
Nucleotide bases
Signup and view all the flashcards
Mitochondrial DNA usage
Mitochondrial DNA usage
Signup and view all the flashcards
Target DNA definition
Target DNA definition
Signup and view all the flashcards
Polymerase Chain Reaction (PCR)
Polymerase Chain Reaction (PCR)
Signup and view all the flashcards
Properties of Taq polymerase
Properties of Taq polymerase
Signup and view all the flashcards
Enzymes usage
Enzymes usage
Signup and view all the flashcards
Outcome of PCR
Outcome of PCR
Signup and view all the flashcards
How PCR is used.
How PCR is used.
Signup and view all the flashcards
Chain Termination
Chain Termination
Signup and view all the flashcards
Evolutionary relationships.
Evolutionary relationships.
Signup and view all the flashcards
Study Notes
- The wet-lab and data analysis workbook is designed as a foundational component of the Genetics Depth Study for the HSC Biology course, tracing DNA markers in molecular diversity analysis with an emphasis on wildlife conservation.
- The wet-lab provides an opportunity to synthesize biological information, make decisions, and produce adaptive management plans, emphasizing the use of biological information and genetic technology to evaluate the impact of human activities on marine biodiversity with Macquarie University.
- The objective of this wet-lab is gaining hands-on experience with the principles and practice of Polymerase Chain Reaction (PCR).
- PCR products are sequenced, aligned, and the species are identified before phylogenetic analysis to build a phylogenetic tree.
HSC Biology Syllabus Content Addressed:
- Questions and hypotheses are developed and evaluated for scientific investigation.
- Select and process appropriate qualitative/quantitative data and information using appropriate media.
- Scientific problems are solved using primary and secondary data, critical thinking skills, and scientific processes.
- Primary and secondary data is analyzed and evaluated
- Scientific understanding is communicated using suitable language and terminology for a specific audience or purpose.
- Natural genetic change is explained in the use of genetic technologies to induce genetic change.
Module 5 Content Outcomes Addressed:
- Technologies are investigated, for example, DNA sequencing and profiling, to determine inheritance patterns in a population (ACSBL064, ACSBL085, ACSBL086).
- Data analysis is investigated from a large-scale collaborative project to identify trends, patterns, and relationships: (ACSBL064, ACSBL073).
- Population genetics data in conservation management is investigated.
Module 6 Content Outcomes Addressed:
- Biotechnology (past, present, and future) uses and applications are investigated (ACSBL087).
- Social implications and ethical uses of biotechnology, including animal examples are analyzed
- Potential benefits for society of research using genetic technologies are evaluated.
- Practical investigations and secondary-sourced investigations are part of scientific investigations and are an essential part of the Year 12 course.
- A minimum of 35 hours of course time should be allocated to practical investigations in depth studies.
- Practical investigations include undertaking laboratory experiments.
- Secondary-sourced investigations include locating and accessing a wide range of secondary data and/or information, and using and reorganizing this data.
Outline of Activities
- Introduction: Lab facilities, evacuation meeting points, toilet location, lab safety and expectations all take place from 9:20-9:30 am
- Module 1: Background information and research questions, DNA extraction content, DNA extraction lab work, and review steps with a Q&A session take place from 9:30-11:15 am
- Recess takes place from 11:00 – 11:30 (30 min)
- Module 2: Gel electrophoresis content, gel electrophoresis lab work for DNA, PCR content, PCR lab work, and a talk to a scientist takes place from 11:30 - 1:00 pm
- Lunch takes place from 1:00 – 2:00 (1 hr)
- Module 3: Gel electrophoresis lab work for PCR products, Sanger sequencing content, Interpret gel electrophoresis results with a DNA vs. PCR gels analysis, and review steps with a Q&A session takes place from 2:00 pm - 3:10 pm
- Module 4: Conducted at school and includes identifying species using DNA sequences in BLAST & BOLD databases, and comparing species identified using phylogenetic analysis in MEGA-X
Procedures, Lab Safety
- There are safety, environmental, financial, and legal implications for you and the university.
- The University will discuss the evacuation meeting point and exit routes.
- Read and understand the instructions completely before starting the experiment and ask the instructor if unaware of something.
Laboratory Safety expectations:
- Inform demonstrator of any spills.
- Immediately wash any contact with substances and wash hands before and + after lab work.
- Maintain a clean, uncluttered work area plus follow all experimental instructions closely, with no eating or drinking in the lab
- No open-toed shoes allowed in laboratories.
Precautions
- Use a spill kit for spills.
- Eye wash station, shower are available
- Handle everything as if it's pathogenic and aisles and exits must be free of obstruction.
- Wear lab coat, safety glasses and gloves when required plus long-hair must be tied back
Key Terms:
- Agarose Gel: Made of agarose extracted from seaweed genera Gelidium and Gracilaria, consisting of repeated agarobiose (L- and D-galactose) subunits creating a polymer. Gel polymers join to make a network of bundles with pores that act as a sieve. Pore size determines the gel's molecular sieving properties.
- Amplification: The generation of multiple copies of a target segment of DNA in vitro through the process of PCR.
- Annealing: Lowering temperature to enable primers to attach to the template DNA.
- Centrifuge: A machine with containers to hold a sample that are rotated rapidly and applies centrifugal forces to its contents to separate fluids of different densities (e.g., red cells from plasma) or liquids from solids.
- Chain termination: When complementary strand synthesis is terminated, nucleotides are stopped being added to the 3' end during elongation of the complementary DNA chain.
- Conservation: Protecting plant and animal wildlife in their natural habitat.
- CO1 Gene: Cytochrome Oxidase 1 (COI), one of the 13 mitochondrial genes, is known as the Barcode of Life. It codes for a protein involved in cellular aerobic respiration and is found in most Eukaryotes.
- Cryptic Species: Individuals that are morphologically identical (look same) but are different species.
- Denaturation: When double-stranded template DNA is heated to separate it into two single strands.
- Dideoxynucleotides: Resemble the 4 nucleotides and can be added to the growing strand during elongation, lack the 3' hydroxy group, preventing further nucleotides from being added, thus terminating elongation and are labelled with a unique fluorescent dye for the sequence identification.
- Dilute: Reduce the concentration of a substance by adding water or another solvent.
- DNA: Deoxyribonucleic acid.
- DNA Barcoding: A method of taxonomy to identify a species based on DNA sequences
- DNA polymerase (Taq): An enzyme that makes new strands of DNA, from thermophilic bacteria (Thermus aquaticus)
- Elongation: The addition of nucleotides to the complementary strand.
- Endangered: Species facing a very high extinction risk.
- Enzyme: A protein catalyst that increases the rate of a reaction without being consumed.
- Gel electrophoresis: A technique scientists use to separate DNA fragments according to their size.
- Genome: An organism's complete DNA complement within a cell.
- Lineage: The exact sequence in which species can be traced back through ancestor populations.
- Mitochondrial DNA: Small circle of DNA within the mitochondria passed from the mother via the mitochondrial egg cell, also known as mtDNA.
- Morphology: A particular form, shape or structure of something.
- Mutation: A change in the nucleotide sequence of an organism's DNA.
- Pellet: Collection of particles at the bottom of a centrifuge tube after centrifugation.
- Phylogenetics: The study of evolutionary relationships by assessing the sequence of common genes.
- Polymerase chain reaction (PCR): A technique of amplifying DNA in vitro via incubation with specific primers, taq polymerase, and nucleotides.
- Primer: Short stretches of DNA that are complementary to the template strand that initiate the PCR reaction, designed to bind to the side of the DNA section to be copied.
- Protein: A chain of amino acids linked by polypeptide bonds.
- Reagent: A substance that acts upon another or causes a chemical reaction.
- Salting out: A method used to extract DNA from a sample using the principle that DNA is insoluble in a high ionic solution and forms a precipitate.
- Sequence divergence: How and when lineages diverged from common ancestry.
- Species: When individuals of a population can interbreed naturally with viable fertile offspring, but do not produce viable fertile offspring when they interbreed with individuals of another population.
- Supernatant: The liquid directly above the pellet after centrifugation.
- Target DNA: The specific DNA region that is being amplified (replicating), and also the gene of interest.
- Variation: Any difference between individuals, cells, or groups of organisms caused either by genetic differences (genotypic variation) or by the effect of environmental factors on the expression of the genetic potentials (phenotypic variation).
Module 1 - Extracting DNA + Gel Electrophoresis
- Questioning and predicting plus processing data and information on DNA barcoding.
- Most cells have an organism's entire DNA complement, which known as the genome.
- Biologists can isolate DNA fragments and study a single gene or determine the base sequence of an entire genome.
- DNA sequencing and profiling use DNA manipulation techniques and considerable genetic variation exists within genomes, making individuals genetically unique, due to meiotic recombination and unique mutations.
- Individuals are identified using their unique combination of variable regions of the genome through DNA fingerprinting.
- Gel electrophoresis is a technique used to separate DNA fragments according to size.
- Forensic scientists compare DNA regions across suspects and samples and conservation/evolutionary biologists and geneticists use DNA profiling and gel electrophoresis.
- DNA profiling and gel electrophoresis are critical for analyzing genetic relationships, especially in endangered species conservation.
- Regions of the genome that don't show great variation contain important genes in basic human functions and are conserved across a broad range of taxa.
- They can be used as a barcode to identify species because they are same for all individuals of the same species and show slight variation between species.
- DNA barcoding identifies species when other methods are not possible in closely related species that are morphologically similar, or organisms lacking key distinguishing features.
- Types of investigations include monitoring populations of cryptic species, checking commercial products, trade in endangered species, and working with ancient or degraded samples.
- DNA is the blueprint for life, and you will be supplied with shark tissue samples from shark nets across NSW beaches to extract the nuclear DNA for analysis.
- DNA barcoding can be performed on any tissue sample with a small sample size via polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP).
- Freeing DNA involves breaking down the tissue matrix to access cells, breaking down the cell/nuclear membranes to access the DNA, and the proteins bound to the DNA.
- This can be completed using household products such as anything to mush up the tissue, enzymes or meat tenderizer to break down proteins bound to the DNA, and detergents to lyse open membranes.
- The overall aim of the practicals is identify from which shark species your sample originated, with a 4 step process for species identification involving:
- DNA extraction
- DNA amplification of a chosen gene using PCR
- Sequencing of the chosen gene
- Analysis to determine the species it came from.
Practical Activity 1: DNA Extraction
- The aim is to extract the DNA from tissue samples of unknown species of shark.
Method:
- Steps to perform:
- Take a sample in labelled microcentrifuge tube, and add 170 µL 5M NaCl
- Vortex 15 seconds to mix
- Centrifuge 14000 rpm, 10 min, to precipitate and remove proteins
- Label a new [1.5 mL] microcentrifuge tube with your sample number while waiting for centrifuge
- Add 770 µL ice cold 100% ethanol (-20°C) to new tube and place back on ice
- When centrifuge finished, pour supernatant (liquid containing DNA) into new tube (containing ice cold ethanol)
- Discard previous tube with remaining solid containing unwanted proteins
- Close new tube and invert tube 5 times to clump DNA
- Centrifuge 14000 rpm, 5 min
- Pour off supernatant and discard (keep tube with DNA pellet)
- Add 300 µL 70% ethanol to DNA pellet (wash DNA)
- Centrifuge 14000 rpm, 5 min
- Pour off as much of the supernatant as possible without disturbing the DNA pellet
- Air dry pellet in heat block, 55°C 10 min plus resuspend in 30 µL sterile water
Materials:
- Consumable:
- Tissue samples, cut into 2 mm³
- Extraction buffer (TNES: 50 mM Tris, 400mM NaCl, 100 mM EDTA, 0.5% SDS).
- Proteinase K (20µg/mL)
- 5M NaCl (sodium chloride)
- Ice-cold 100% ethanol
- 70% ethanol
- Sterile water
- Eppendorf tubes (1.5 mL) and Pipette tips
- Equipment:
- Water bath
- Vortex
- Microcentrifuge
- Heat block
- Micropipettes: 10-100 µl and 100-1000 μι
- Pen for marking tubes
- Liquid waste container
- You now have a pure DNA sample and you must clean up by pouring all liquid waste into the container provided and not down the sink.
- Risk assessment:
- Fire risk from ethanol by keeping the ethanol away from open flames, clean up any spills and notify staff if fire starts.
- Risk of slipping on liquids by being careful when using/transferring liquids and clean up any spills with paper towels on occurrence.
- Discussion questions:
- What is the aim of the DNA extraction step? To release the DNA from the cells.
- Where is DNA found in the cell? In the nucleus predominantly with a small amount found also in the mitochondria.
- What barriers do we need to break to free the DNA? Tissue matrix, cell/nuclear membranes, and proteins which are broken down using detergent to lyse membranes and enzymes.
- What is the role of proteinase K? To buffer DNA by degrading proteins that interfere.
- What is the purpose of heating the samples to 55 degrees celcius? It is the optimum temperature for the Proteinase enzyme so most proteins in the sample break down.
- What happens when we add salt to the sample? Salt makes the DNA molecules insoluble in water, easing the protein molecules' detachment and making extraction easier.
- What happens to the sample when ice cold ethanol is added? The cold prevents the DNA from denaturing and makes the DNA clump in a pellet away from the supernatant and allow separation, thus.
- We want lots of DNA copies to produce clear bands and allow repeated analysis.
Agarose Gel Electrophoresis
- Gel electrophoresis is a critical tool used to analyze genetic relationships in familial relationships, forensic investigation, and evolutionary relationships.
- Agarose is used to create a gel matrix that has pores and DNA is forced through these pores when an electric current is applied across the gel.
- DNA is negatively charged, moving towards the positive electrode, with larger pieces of DNA lagging while smaller pieces are able to move faster and farther.
- Gel electrophoresis can separate DNA based on base-pair length to check if a PCR worked, separating pieces of DNA to later sequence, or to check integrity of a DNA sample.
- A dye combined with the gel that fluoresces under UV light visualises the DNA on the gel, with a sharp band indicating quality and fuzzy bands/smears indicating degraded DNA.
- Steps in gel electrophoresis:
- Making the agarose gel with 2g agarose powder in {1x} 100 ml TAE/TBE buffer
- Adding GelRed stain will cause DNA to glow under UV light, with brightness of the band correlating to the amount of DNA, and position indicating fragment size.
- Measuring the size of the fragments by using ladders or markers of known sizes,
- The movement of the fragments in the gel matrix tells us about their relative size
- Amount of agarose (2%), Voltage (110v), and Run duration (30 mins) influence how far the fragments will move.
- Loading the wells by adding a dyed DNA solution into liquid buffer inside the well to see it has already be loaded due to being visibly heavy
- The wells are covered by TBE buffer
- A ladder will go in the first lane plus sometimes the last lane.
- The expectations are bright bonds at the top of the gel with large fragments, with small fragments at the bottom are not the DNA of interest.
Practical Activity 2: Agarose Gel Electrophoresis Process
- Run DNA samples on agarose gel, and check integrity of extracted DNA (quality control
- The facilitator will prepare a 2% agarose gel:
- 2 g agarose powder is analytical grade
- 100 ml TAE/TBE buffer is acetate or borate
- 2 µl GelRed is DNA-binding and UV-fluorescent dye
- Gel tray is set up with a comb
- Agarose is added to buffer in flask, microwave and swirl periodically
- Agarose becomes clear when is melted.
- When agarose is cooled slightly GelRed is added then swirled
- The contents are poured into tray in a single movement , with any bubbles popped with a tip pipette
- It is set to completely set by around 30 mins.
- Method:
- Prepared for you:
- Agarose gel will be placed in tank, and the TAE/TBE buffer is then poured to cover it.
- And the DNA ladder will be loaded into first (and last) lane of gel
- Steps to perform:
- New microcentrifuge tube use a pipette to add 10 micro litres loading dye into it.
- And use another pipette to add 10 micro litres of your resuspend the DNA sample into that said tube- using a very slow mixing action to avoid the shearing of DNA
- Finally you use a pipette to add a total of 15 micro litres to you well. Of course be careful when ejection into the well as is crucial to avoid any damage to the agarose
- Write your name to your corresponding loading sheet right next to loaded tube label.
- Once loaded, the gel tank will have its electrodes connected to a power supply, and turned on (at 110v for 40 minutes).
- Observe the gel starting to “run”: bubbles will rise from the electrodes, and shortly the dye will appear to migrate into the gel; this means that the DNA is also being forced into the gel ("electrophoresis").
- The gel electrophoresis will be stopped before the dye reaches the end.
- It can then be visualised using a UV-light and the again again at a later step
- By comparing the brightness of a band to a “standard” concentration of DNA, an agarose gel can also be used to quantify DNA.
- Prepared for you:
Module II - Performing Polymerase Chain Reaction (PCR)
- Processing data and information
- What is PCR?
- Polymerase Chain Reaction (PCR) is a widely spread application used to amplify DNA with a variety of uses in DNA application and gel electrophoresis
- In this particular section you will be performing DNA extraction to allow earlier extraction.
- The PCR process is an artificial process that replicated under laboratory conditions
- Each cycle double effectively
- A common sequence would be about 30cycles which will result in one billion pieces(2 to the power of 30)
- Stages of the PCR process
- Performed in a thermal cycler to maintain a variance in temperature during the replica process
- Steps are
- Initial Denaturation
- Annealing
- Polymerisation
- Steps are
- Performed in a thermal cycler to maintain a variance in temperature during the replica process
DNA Barcode selection:
- COI
- Select an area from the Cytochrome Oxidase 1 one of 13 mitochondria genes , that a known barcode. mtDNA is a closed double strand a the D.NA in the mitochondria For the species identification aspect we need a genes that is fairly variable that a species but has a degree of internal constancy( if its too conserved then it isn't effective and if it is too distinct amongst species differentiation becomes hard/impossible). Why is COI ideal? Is is found in most eukaryotes, is heavily mitochondria , this means as a greater chancy of dna extraction , lacks and form of recomboniation with in its self , change and alteration through mutation therefore changes would be highly significant through long periods of time.
PCR
- Requires many copies to make that barcode
Ingredients:
- Needs many ingredients:
Primers: short DNA pieces
DNA: building blocks for new DN strands
- buffer is the right environment
- Magnesium and DNA : Dna synthesis and primer annealing a right conditions
Primer Sequence(26 bases)
- FishF1(FWD)- TCAACCAACCACAAAGACATTGGCAC
- HCO2198(REV)- TAAACTTCAGGGTGACCAAAAAATCA
- Short DNA single pieces The test accounts for the strength of connection through account for bonding amongst atoms and their pairing
Denaturation
- Denatures and separates parts of those atoms through hydrogen for separation and targeting.
Annealing
- Cooling allows that the DNA being short and strands allowing connection from each end.
Extension
- A strong heta able polymerase , derived , the strands allow a connecting of each end
The Main Summarised
-
Initial-25 degree , 1 min
-
Separation- 94 degrease per 30
-
Annela -52 at 30 sec
-
Extract : build 27 deg for 1 min
- All repeated at 35 and multiple times.
-
PCR: Exponential increasing that copies the barcode Discussion: After checking we need DNa extract to work to show possible that has been extracted
-
We need : Skin hair or saliva and blood.ShortDNA section and barcode, Co1gene only.Why use CO1gene there's no variation , the is low resulting in different species and same
-
The region of codins that we want bind too.The enzyme derives allows no change when changing
-
The result shows there's enough CO1 to analysis a gel. Pcr is heavily use to copy and help identify comparison .
The experiment
- Mixes a tube
- Mark it and Label it
- Follow table two
Module Three - Analysis Of PCR
The is the interpretatio of results with Gel Analysis by gel- We have that our extraction was correct
-
Good qutlty to show an whole genome
-
Show a line and that equal to that amplified sequence
-
Small section at the bottom of short sequence. You'll get a product load 10 sequence
-
Dideoycucotise- stops at repilation to prepare for base.Helps the samples be sequenced . Sanger relises on principles of polymersttialtion . Sanger helps
Module four - What animal
- Online access helps the Mega BlAST ad Bold, to analyse from different species. From.mega you will need you device because it needs you device . From there you must fallow the steps You must remember to write down what is 100% so results can be recorded. From there do that that in the bond database
- Is there only. One possible, can there be multiple matches.
The discussion
-
The there is most definitely. 1 match Look at their sequence closeness so there can be more information If complete again sequence the , for any inperfections or any. The phylogenetic is where a tree forms and is able to to identify what their relationship is Phylogemy has a intrest in the history related
-
There’s different phylogenic for different regions Helps understand data and information Polotomy help identify lineage that is required to help with further data Sequence can create a pitch fork
-
Phylogentic patterns can be use to divulgé a complex sight into with the geographical area From these sequences will from closer relation Was it accurate- it does have a few holes from which the data derive
Studying That Suits You
Use AI to generate personalized quizzes and flashcards to suit your learning preferences.