Glob Package and Regex in Python
42 Questions
1 Views

Choose a study mode

Play Quiz
Study Flashcards
Spaced Repetition
Chat to Lesson

Podcast

Play an AI-generated podcast conversation about this lesson

Questions and Answers

What is the primary purpose of the glob package in Python when dealing with files in a directory?

  • To automatically execute all `.py` files in a given directory.
  • To create a detailed log of all file modifications within a directory.
  • To encrypt all files in a directory for security purposes.
  • To generate a list of files that match a specified pattern in a directory. (correct)

In the context of processing multiple files in a loop, what is the advantage of modularizing the task into functions?

  • It increases the execution time of the script due to function call overhead.
  • It reduces the number of files that can be processed in a single run.
  • It makes the script more complex and harder to understand.
  • It simplifies the main loop and makes the code more reusable and maintainable. (correct)

Given the code file_list = glob('*.py'), what will file_list contain?

  • An error message indicating that no Python files were found.
  • A list of strings, where each string is the name of a Python file in the current directory. (correct)
  • A string containing the names of all Python files.
  • The number of Python files in the current directory.

You have a directory with the files data1.txt, data2.txt, results.csv, and script.py. Which glob expression would return only data1.txt and data2.txt?

<p><code>glob('data*.txt')</code> (C)</p> Signup and view all the answers

Consider a scenario where you need to process all .log files in a directory, extract specific data from each, and store the processed data into a list. How should you structure your code using glob and modular functions?

<p>Use <code>glob</code> to get the log files, create a function to process each file, and append the results to a list. (D)</p> Signup and view all the answers

Which of the following is NOT a typical application of identifying potential transcription factor binding sites using regular expressions?

<p>Simulating protein folding dynamics. (B)</p> Signup and view all the answers

What is the primary role of meta-characters in regular expressions?

<p>To add flexibility and specificity to search patterns. (B)</p> Signup and view all the answers

Which regular expression element defines a character class, allowing you to match any single character within that class?

<p>[] (B)</p> Signup and view all the answers

Consider the Canadian postal code pattern. Which regular expression accurately represents it, assuming all letters are uppercase and '\s' represents a whitespace?

<p>[A-Z][0-9][A-Z]\s[0-9][A-Z][0-9] (D)</p> Signup and view all the answers

In regular expressions, what is the function of the $ meta-character?

<p>Matches the end of a string. (D)</p> Signup and view all the answers

What is the difference between the * and + quantifiers in regular expressions?

<p><code>*</code> matches zero or more occurrences, <code>+</code> matches one or more occurrences. (B)</p> Signup and view all the answers

Given the python code: import re pattern = re.compile("[A-Z][0-9][A-Z]\s[0-9][A-Z][0-9]") test_string = "K8N 5H3" result = pattern.match(test_string)

What will be the value of bool(result)?

<p><code>True</code> (B)</p> Signup and view all the answers

Which of the following regular expressions would be most suitable for identifying a sequence that consists of at least one uppercase letter, followed by any digit, and ending with any character?

<p>[A-Z]+[0-9]. (C)</p> Signup and view all the answers

In Biopython, what is the primary purpose of using SeqIO.parse()?

<p>To iterate over sequence records in a file. (A)</p> Signup and view all the answers

Given a SeqRecord object sr in Biopython, how would you correctly extract the sequence as a string, taking only the first 20 characters?

<p><code>str(sr.seq)[0:20]</code> (C)</p> Signup and view all the answers

What is the correct way to retrieve the identifier (ID) of a SeqRecord object named sr and store the first 20 characters of this identifier in a variable?

<p><code>id = sr.name[0:20]</code> (D)</p> Signup and view all the answers

When searching for patterns in biological sequences using Python, why is it important to consider case sensitivity?

<p>Biological sequences (DNA, RNA) are inherently case-sensitive; 'A' is different from 'a'. (A)</p> Signup and view all the answers

You have a list of FASTA files (file_list) and want to count them. Which Python code snippet is the most efficient way to determine the number of files in the file_list?

<p><code>count = len(file_list)</code> (A)</p> Signup and view all the answers

Suppose you want to print each sequence from multiple FASTA files located in a directory. Which approach is the most appropriate using Biopython?

<p>Use <code>SeqIO.parse()</code> in a nested loop, first iterating through the files and then through each record in the file. (B)</p> Signup and view all the answers

What is the significance of using the glob module in conjunction with Biopython for sequence analysis?

<p><code>glob</code> facilitates batch processing of multiple sequence files by matching file patterns. (D)</p> Signup and view all the answers

Which of the following is a key reason why searching for patterns in biological text (sequences) is essential in biology?

<p>To identify functional elements, mutations, or conserved regions within the sequences. (C)</p> Signup and view all the answers

Given a DNA sequence, what is the primary reason the .find() method is insufficient for locating all start codons (ATG) in both strands?

<p>The <code>.find()</code> method only returns the first occurrence of the start codon and doesn't account for different reading frames. (D)</p> Signup and view all the answers

What operation is performed by the following code: cdna_seq.reverse_complement()?

<p>It generates a sequence that is both reversed and has each nucleotide replaced by its complementary base (A with T, and C with G). (C)</p> Signup and view all the answers

What is printed to the console when the following code is executed, assuming cdna is defined as in the content: for m in re.finditer("ATG", cdna): print(m.start(),m.end(),m.group(0))

<p>The start and end indices of every occurrence of 'ATG' in the <code>cdna</code> sequence along with the sequence 'ATG'. (B)</p> Signup and view all the answers

Which of the following is the most accurate description of a dictionary in the context of programming?

<p>A data structure that stores key-value pairs, where each key is unique. (B)</p> Signup and view all the answers

Given the DNA sequence cdna = 'GCTCCTTCATCATGAACTGGCACATGATCATCTCTGGGCTTATTGTGGTAGTGCTTAAAGTTGTTGGAATGACCTTATTTCTACTTTATTTCCCACAGATTTTTAACAAAAGTAACGATGGTTTCACCACCACCAGGAGCTATGGAACAGTCTGCCCCAAAGACTGG', what will following python code print?

cdna_seq = Seq(cdna) comp_cdna = cdna_seq.reverse_complement() print(comp_cdna)

<p><code>CCAGTCTTTGGGGCAGACTGTTCCATAGCTCCTGGTGGTGGTGAAACCATCGTTACTTTTGTTAAAAATCTGTGGGAAATAAAGTAGAAATAAGGTCATTCCAACAACTTTAAGCACTACCACAATAAGCCCAGAGATGATCATGTGCCAGTTCATGATGAAGGAGC</code> (C)</p> Signup and view all the answers

What is the purpose of the ^ and $ symbols in regular expressions?

<p><code>^</code> anchors the match to the start of the string, and <code>$</code> anchors it to the end. (C)</p> Signup and view all the answers

In the provided code, what does [^STL]ARSE achieve in the regular expression?

<p>Matches any word ending in 'ARSE' where the character before 'ARSE' is not 'S', 'T', or 'L'. (B)</p> Signup and view all the answers

Why might comparing the lengths of proteins translated from different start codons on both strands of a cDNA sequence help in identifying the correct coding sequence (CDS)?

<p>The correct CDS is likely to produce a longer, functional protein compared to incorrect start sites or non-coding regions. (D)</p> Signup and view all the answers

Given the code snippet, what is the most likely outcome of the following lines of code?

guess1 = "SNAKE"
pattern1 = re.compile("[^S][^N][^A][^K]E")

<p>It creates a regular expression pattern to find words ending in 'E' where the first four letters are not 'S', 'N', 'A', and 'K' respectively. (B)</p> Signup and view all the answers

If all_words is a list of strings, what is the effect of the statement all_words.append(l)?

<p>It adds the list <code>l</code> as a single element to the end of the <code>all_words</code> list. (B)</p> Signup and view all the answers

Consider the following code. What will happen if the condition c > 5 is changed to c > 2?

<p>The loop will terminate after finding only 3 matching words. (D)</p> Signup and view all the answers

In the context of the mRNAdle example, what is the significance of 'reverse-translating' a sequence in Python?

<p>It finds the complement of a DNA sequence, which is necessary to analyze both strands. (B)</p> Signup and view all the answers

The code uses a for loop with an if statement and a counter c. What is the primary purpose of the counter c in this loop?

<p>To limit the number of matches printed to the console. (B)</p> Signup and view all the answers

What are the key characteristics that define a Python dictionary?

<p>Unordered and mutable. (B)</p> Signup and view all the answers

Using the provided genetic_code Python dictionary, what amino acid does the codon 'GCA' code for?

<p>A (D)</p> Signup and view all the answers

In the mRNA translation example, what is the purpose of the break statement within the loop?

<p>To terminate the loop when a stop codon is encountered. (C)</p> Signup and view all the answers

If the maybe_cds sequence is 'AUGCGU', and using the provided genetic_code dictionary, what would be the resulting peptide after running the amino acid counting code?

<p>MR (A)</p> Signup and view all the answers

In the mRNA translation example, the maybe_cds variable is assigned cdna[11:]. What does this indicate?

<p>Both B and C. (D)</p> Signup and view all the answers

What is the significance of the start codon (ATG) and stop codons in genomic sequence data?

<p>They mark the beginning and end of genes. (D)</p> Signup and view all the answers

If the genetic_code dictionary were missing the entry for 'GGC', how would the translation code respond when encountering this codon in maybe_cds?

<p>It would raise a KeyError exception. (C)</p> Signup and view all the answers

Why is it important to consider different reading frames when analyzing a sequence of DNA?

<p>The correct reading frame ensures the inclusion of the start codon and proper translation of the gene. (B)</p> Signup and view all the answers

Flashcards

Glob Package

A Python module used to find file pathnames matching specified patterns.

Wildcard (*)

A character in glob that matches any number of characters in filenames.

File Processing Loop

A structure that iteratively applies an action to each file in a list.

do_a_thing function

A placeholder function in a loop used to perform an operation on each file.

Signup and view all the flashcards

Modular Functions

Reusable code blocks that make programming tasks easier and cleaner.

Signup and view all the flashcards

BioPython

A Python library for biological computation involving DNA, RNA, and protein sequences.

Signup and view all the flashcards

SeqRecord

An object in BioPython that holds sequence data and its associated metadata.

Signup and view all the flashcards

Attributes of SeqRecord

Components of SeqRecord include 'seq' for sequences and 'id' for identifiers.

Signup and view all the flashcards

Converting objects to strings

BioPython allows conversion of sequence objects into string format for easier manipulation.

Signup and view all the flashcards

Pattern searching in strings

Finding specified sequences within text using conditions.

Signup and view all the flashcards

Exact matches

Searching for a specific substring within a larger text, returning true if found.

Signup and view all the flashcards

Approximate matches

Finding close matches in strings based on certain criteria, rather than exact letters.

Signup and view all the flashcards

Importance of patterns in biology

Identifying patterns can reveal biological significance and help in data analysis.

Signup and view all the flashcards

cDNA

Complementary DNA synthesized from a messenger RNA template.

Signup and view all the flashcards

Reverse Complement

A sequence obtained by reversing the nucleotide order and substituting each nucleotide with its complement.

Signup and view all the flashcards

Finding ATG

The process of locating the start codon sequence in DNA or cDNA strands.

Signup and view all the flashcards

Regular Expressions

A powerful search tool in programming for pattern matching in strings.

Signup and view all the flashcards

Dictionary in Python

A data structure that stores key-value pairs where keys are unique.

Signup and view all the flashcards

Transcription Factor Binding Sites

Specific regions in DNA where transcription factors attach to initiate transcription.

Signup and view all the flashcards

Degenerate Primer Binding Sites

Locations where primers with mismatches might still bind to DNA, leading to non-specific amplification.

Signup and view all the flashcards

Regular Expressions (regex)

A sequence of characters defining a search pattern within text.

Signup and view all the flashcards

Meta-characters in regex

Special symbols that perform specific functions in regex, like matching any character.

Signup and view all the flashcards

Pattern of Canadian Postal Codes

Every Canadian postal code follows the pattern Letter-Number-Letter Space Number-Letter-Number.

Signup and view all the flashcards

Character Classes in regex

Defined using brackets [], it matches any character within the specified range.

Signup and view all the flashcards

Braces in regex

Used to specify the number of matches required, like {m} for exactly m matches.

Signup and view all the flashcards

Whitespace in regex

Represented by , it matches spaces in strings.

Signup and view all the flashcards

Unordered Dictionary

A dictionary with no implicit order, differing from arrays.

Signup and view all the flashcards

Mutable

A property of objects that allows updates and changes, such as adding keys or modifying values.

Signup and view all the flashcards

Genetic Code Dictionary

A dictionary mapping codons (three-base sequences) to amino acids or stop signals.

Signup and view all the flashcards

Start Codon

The specific nucleotide sequence (e.g., ATG) that signals the start of translation.

Signup and view all the flashcards

Stop Codon

Nucleotide sequences (e.g., TAA, TAG, TGA) that signal the end of translation in protein synthesis.

Signup and view all the flashcards

Peptide Sequence

The sequence of amino acids linked together, forming part of a protein.

Signup and view all the flashcards

Amino Acid Count

The number of amino acids before the first stop codon in a translation process.

Signup and view all the flashcards

Reading Frame

The way nucleotides are divided into triples (codons) during translation.

Signup and view all the flashcards

Regex Pattern

A sequence of characters used to define a search pattern in strings.

Signup and view all the flashcards

Anchoring in Regex

Using ^ and $ to match patterns at the beginning or end of strings.

Signup and view all the flashcards

Regex Match

The process of checking if a string fits a regex pattern.

Signup and view all the flashcards

Limit Matches

Setting a condition to stop finding matches after a certain number.

Signup and view all the flashcards

Finding Start Codons

Identifying specific nucleotide sequences that signal the start of protein coding.

Signup and view all the flashcards

mRNAdle Project

A project focused on translating DNA sequences to find coding regions.

Signup and view all the flashcards

Reverse-Translate

The process of converting a protein sequence back to its nucleotide sequence.

Signup and view all the flashcards

Matching Larger Words

Using regex to match longer words by establishing specific patterns.

Signup and view all the flashcards

Study Notes

MBB110 Data Analysis for Molecular Biology & Biochemistry (Spring 2025) - Lecture 5

  • Lecture 5: Regular expressions and pattern matching

  • Focuses on finding common motifs

  • Learning objectives:

    • Shared Libraries: How to import from Python libraries
    • BioPython: Familiarity with features for manipulating sequences
    • Pattern Matching: Familiarity with advanced methods for pattern matching using command-line tools.
    • Regular Expressions: Applying regular expressions specifically in Python

  • Importing from packages:

    • Python has standard modules and thousands of packages
    • A module is a file with functions or class definitions
    • A package is a collection of modules sharing a namespace
    • Modules can be accessed using import
    • PYTHONPATH environment variable can be used to add locations where Python can find additional modules.

  • Working with filesystems:

    • Code can process multiple files
    • glob module is used to get files in a directory matching a certain pattern
    • Use glob() function to create a list of matching files for operations.

  • Bash-like glob:

    • The * symbol is a wildcard that matches any character
    • Example of glob use in Python:
    from glob import glob
file_list = glob("/path/to/files/*.py") 
print(file_list)

  • Processing many files in a loop:

    • The strategy for finding and processing files is common
    • Find the files using glob and then process them with loops

  • Using BioPython to load FASTA Data:

    • BioPython is a useful package for working with biological data, such as sequences.
    • Biopython makes it easier to work with biological files.

  • From BioPython objects to strings:

    • BioPython objects have attributes for components

  • Let's summarize multiple sequences:

    • Iterate through files to extract information
    • Example code showing the use of Biopython SeqIO for parsing files.

  • Searching for Patterns in text:

  • Approximate matches: Example code to find matches using regular expressions and the functionality of .match() or an appropriate function

  • Why are patterns important in biology:

    • Identifying potential transcription factor binding sites
    • Predicting off-target or degenerate primer binding sites
    • Finding oligonucleotide repeats.

  • Regular expressions (regex):

    • A structured way to define search patterns.
    • Basic form is a literal character match
    • More power comes from using metacharacters for complex patterns
    • Examples of metacharacters include *, +, ?, .

  • Regular expressions for postal codes:

    • Patterns for postal codes are provided to help illustrate the structure of regex.

  • Brackets and braces for classes and repetition:

    • Explanation of {}, [], and special characters like * in regular expressions (regex), including how they work and what they match.

  • Using regular expressions in Python:

  • Example of how to use regular expressions (regex) in Python code, demonstrating the use of re.compile() and re.match().

  • Special matching characters in regex: Explanation of special characters like ., *, + in regex

  • Introduction to Wordle: Game details.

  • Regex for this mystery word: A regex example to solve a Wordle-like puzzle.

  • Step 1: Loading the word file;

  • Step 2: Start guessing;

  • Step 3: The next guess;

  • Step 4: One more try;

  • What if our list included larger words?: Regular Expressions for Anchoring

  • mRNAdle: Guessing the coding segment (CDS):

    • Finding the coding segment in a cDNA sequence given a FASTA file.
    • Translation from each start codon.
    • Comparing the lengths of proteins.
    • Explanation of the strategy used to generate the solution for the problem

  • mRNAdle example (Reverse-translating and sequence analysis): examples to reverse translate and search for ATG pattern

  • Regular expressions for finding patterns in sequences

  • mRNAdle example (translating into amino acids): translating into amino acids from a nucleotide sequence and extracting the peptide sequence.

  • Dictionaries:

    • A dictionary is a collection of key-value pairs.
    • Each key is unique, and values can be any data type.
    • A real-word dictionary analogy helps in understanding

  • Genetic code as a python dictionary;

  • Summary:

    • Genomic data contains motifs used for predictions, e.g. start/stop.
    • Python's regex package is useful for finding motifs in biological analysis.

  • Lab this week - work with patterns in code.

  • Q&A

Studying That Suits You

Use AI to generate personalized quizzes and flashcards to suit your learning preferences.

Quiz Team

Related Documents

MBB110 Data Analysis for Molecular Biology & Biochemistry (Spring 2025) Lecture 5 PDF

Description

This quiz covers the use of the glob package for file handling in Python, including file processing in loops and using modular functions. It also covers regular expressions, focusing on meta-characters and character classes.

More Like This

CEST-CE Term_2 GNU/LINUX (Week 6)
40 questions

CEST-CE Term_2 GNU/LINUX (Week 6)

LuxuryAbundance avatar
LuxuryAbundance
Glob (1)
5 questions

Glob (1)

LushMossAgate1393 avatar
LushMossAgate1393
Glob (2)
7 questions

Glob (2)

LushMossAgate1393 avatar
LushMossAgate1393
Use Quizgecko on...
Browser
Open
Browser
Browser