Podcast
Questions and Answers
What is the significance of the name 'Deoxyribonucleic Acid' in terms of DNA's composition?
What is the significance of the name 'Deoxyribonucleic Acid' in terms of DNA's composition?
The name indicates that DNA contains Deoxyribose (a 5-carbon sugar) and is a Nucleic Acid (molecule made up of nucleotides)
What are the three components of a nucleotide, and how do they relate to the structure of DNA?
What are the three components of a nucleotide, and how do they relate to the structure of DNA?
The three components are a sugar molecule, a nitrogen base, and a phosphate group, which are joined together to form the nucleotides that make up the DNA molecule
What is the relationship between the nitrogen bases and the genetic code, and how do they contribute to the structure of DNA?
What is the relationship between the nitrogen bases and the genetic code, and how do they contribute to the structure of DNA?
The nitrogen bases form the 'letters' of the genetic code, and they pair with each other to form the rungs of the DNA molecule
How does the structure of DNA relate to its function as a molecule of genetic information?
How does the structure of DNA relate to its function as a molecule of genetic information?
Signup and view all the answers
What is the significance of the sugar-phosphate backbone in the structure of DNA?
What is the significance of the sugar-phosphate backbone in the structure of DNA?
Signup and view all the answers
How does the twisted shape of DNA molecules, known as a double helix, contribute to its function as a molecule of genetic information?
How does the twisted shape of DNA molecules, known as a double helix, contribute to its function as a molecule of genetic information?
Signup and view all the answers
What is the significance of Rosalind Franklin's 1952 X-ray diffraction image of DNA, and how did it impact the discovery of the double helix structure?
What is the significance of Rosalind Franklin's 1952 X-ray diffraction image of DNA, and how did it impact the discovery of the double helix structure?
Signup and view all the answers
What is the basis of the base pairing rules in DNA, and how do they determine the complementary DNA strand?
What is the basis of the base pairing rules in DNA, and how do they determine the complementary DNA strand?
Signup and view all the answers
What is a gene, and what is its role in the genetic organisation of the cell?
What is a gene, and what is its role in the genetic organisation of the cell?
Signup and view all the answers
How do the two strands of nucleotides in DNA form a double helix structure, and what is the role of hydrogen bonds in this structure?
How do the two strands of nucleotides in DNA form a double helix structure, and what is the role of hydrogen bonds in this structure?
Signup and view all the answers
What is the relationship between the genome and the genetic organisation of the cell?
What is the relationship between the genome and the genetic organisation of the cell?
Signup and view all the answers
Given a DNA strand that reads: ATACGTAGCGATTAAGGACCTTTAGAA, what would its complementary DNA strand be?
Given a DNA strand that reads: ATACGTAGCGATTAAGGACCTTTAGAA, what would its complementary DNA strand be?
Signup and view all the answers
What is the physical structure of a chromosome, and what is the function of the proteins it is wrapped around?
What is the physical structure of a chromosome, and what is the function of the proteins it is wrapped around?
Signup and view all the answers
What is the significance of the term 'locus' in relation to gene structure, and what is the plural form of the term?
What is the significance of the term 'locus' in relation to gene structure, and what is the plural form of the term?
Signup and view all the answers
What is the difference between the structure of DNA in prokaryotic cells versus eukaryotic cells, and what is the significance of this difference?
What is the difference between the structure of DNA in prokaryotic cells versus eukaryotic cells, and what is the significance of this difference?
Signup and view all the answers
What is the significance of the double helix model of DNA, and how does it relate to the structure of nitrogen bases?
What is the significance of the double helix model of DNA, and how does it relate to the structure of nitrogen bases?
Signup and view all the answers
What is the role of hydrogen bonds in the structure of DNA, and how do they differ from covalent bonds?
What is the role of hydrogen bonds in the structure of DNA, and how do they differ from covalent bonds?
Signup and view all the answers
How does the sequence of nitrogen bases in DNA determine the traits of an organism, and what is the relationship between DNA and the physical characteristics of an organism?
How does the sequence of nitrogen bases in DNA determine the traits of an organism, and what is the relationship between DNA and the physical characteristics of an organism?
Signup and view all the answers