Data Retrieval and Analysis

Data Retrieval and Analysis

• The range of online databases and resources provides a wealth of information
• Crucially, understanding which databases exist, which tools enable searching, and which tools analyze data across resources is needed

Searching for a Gene of Interest

• Determining whether you need nucleotide or protein sequences is the first step
• You need to know if you require genomic or RNA-derived nucleotide sequences
• You need to know if you want all possible sequences that exist, or just curated ones
• Retrieving a sequence involves finding and interpreting the annotated information in the sequence features table
• The sequence features table contains information about the different kinds of features such as gene, mRNA, coding region, and tRNA

Gene Identification or Annotation Questions

• The characterization of genomic features using computational and experimental methods helps answer the following:
• Which region codes for a protein?
• Which DNA strand is used to encode the gene?
• Where does the gene start and end?
• Where are the exon-intron boundaries?
• Where are the regulatory sequences for that gene?

Bioinformatics Resources

• Two of the most popular bioinformatics resources are:
• National Centre for Biotechnology Information (NCBI)
• European Bioinformatics Institute (EMBL-EBI)

NCBI

• National Centre for Biotechnology Information (NCBI) is an NIH-funded initiative
• It was established to store molecular biology information
• It has grown since the completion of the human genome project and the reduction in sequencing costs
• It develops and maintains a variety of databases and resources

GenBank

• GenBank is the NIH genetic sequence database
• It contains an annotated collection of all publicly available DNA sequences
• The database is updated regularly

NCBI - DNA and RNA

• NCBI provides access to DNA and RNA sequence data via its comprehensive databases

NCBI - Expanding Beyond DNA Data

• NCBI's extensive resources extend beyond just DNA data

EMBL-EBI

• The EMBL-EBI maintains the world's most comprehensive range of freely available and up-to-date molecular databases
• EMBL-EBI also offers online and live training events for using their resources
• The training can be found at this URL: https://www.ebi.ac.uk/training/

Sequence Data Formats

• A sequence data format is a specific layout that uses text, characters, symbols, keywords, and descriptions to identify a sequence and its attributes
• A typical file includes text, numbers, and simple signs, and is readable and printable by a computer

FASTA Format

• FASTA stands for "fast all" and is a simple and widely used format for storing biological sequences
• Essential for sequence-data input in various sequence-analysis programs

FASTA Format Crucial Elements

• The definition line starts with the ">" sign and is a crucial element
• Analysis programs will fail without the ">" sign included
• There should be no space between the ">" sign and the first letter of the definition
• Lines after the header contain the DNA or protein sequence, using a one-letter code, and can be written with or without gaps

FASTA Format Examples

• Example 1: >Mouse Oatp-5 protein MGEPGKRVGI HRVRCFAKI KVFVYM
• Example 2: >Mouse Oatp-5 mRNA ATCAATTTAGATTAAAGCTTATATGCA

Sequence Flat File Format

• When submitting a sequence, relevant information must be included, such as:
• Name of mRNA or gene
• Source
• Author
• Annotation
• Version
• Open reading frame
• Putative translation product
• All information is displayed, along with the sequence, in a flat file

GenBank Data Flat File Components

• Consists of a LOCUS field containing various data elements:
• Locus name
• Sequence length
• Molecule type
• GenBank division
• Modification date
• Example LOCUS: AH002844 4969 bp DNA linear PRI 10-JUN-2016

GenBank Division

• The GenBank division is indicated with a three-letter abbreviation
• The GenBank database is divided into 18 divisions, including:
• PRI (primate sequences)
• ROD (rodent sequences)
• MAM (other mammalian sequences)
• VRT (other vertebrate sequences)
• INV (invertebrate sequences)
• PLN (plant, fungal, and algal sequences)
• BCT (bacterial sequences)
• VRL (viral sequences)
• Examples:
• LOCUS AH002844 4969 bp DNA linear PRI 10-JUN-2016
• LOCUS AF213260 2798 bp mRNA linear ROD 31-JAN-2001

DEFINITION

• Brief description of sequence, which includes source organism, gene/protein name, and function when non-coding
• If the sequence has a coding region (CDS), a completeness qualifier follows, such as "complete cds"
• Example: DEFINITION Homo sapiens insulin (INS) gene, complete cds

ACCESSION

• Unique identifier for a sequence record, combining letters and numbers
• For example, it is a single letter followed by five digits (e.g., U12345)
• Another example is two letters followed by six digits (e.g., AF123456)
• It is a stable way of identifying GenBank entries
• It is also used for both DNA and proteins
• Example: ACCESSION AF213260

Accession Numbers

• Each GenBank record is assigned a unique accession number
• The record includes both a sequence and its annotations

Accession Number Prefixes

• Accession number prefixes indicate sequence types in the GenBank database
• NC_ or NG_
• Known Refseq, genomic regions or assembly
• NM_
• Known Refseq, mRNA
• NR_
• Known Refseq, RNA
• NP_
• Known Refseq, protein
• NT_ or NW_
• Known Refseq, genomic contig or scaffold
• XM_
• Model Refseq, mRNA
• XR_
• Model Refseq, RNA
• XP_
• Model Refseq, protein
• AH, annotated from high-throughput genomic/transcriptomic studies

VERSION

• Version is a nucleotide sequence identification number representing a single, specific sequence in GenBank
• If any change occurs to the sequence data, the version number increases (e.g., U12345.1 to U12345.2)
• The accession portion will remain stable

GI

• GI stands for "GenInfo Identifier", which is a sequence identification number for the nucleotide sequence
• if a sequence changes in any way, there will be a new GI number assigned
• For example, VERSION AF213260.1 GI:12619376

KEYWORDS

• Keywords are words or phrases which describe the sequence
• Keywords are generally present in older records
• Known examples are GC rich region, insulin, polymorphic variation and tandem repeat

SOURCE

• This includes information, including an abbreviated form of the organism name, sometimes followed by a molecule type
• Example: SOURCE Homo sapiens (human)

Organism

• This is the formal scientific name for the source organism, and its lineage
• The data is based on the phylogenetic classification scheme used in the NCBI Taxonomy Database
• Example: ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo

REFERENCE

• Publications by the authors of the sequence that discuss the data
• References are automatically sorted within the record based on date of publication, showing the oldest references first

Source Example

 - REFERENCE 1
 - AUTHORS Beeckmans,S., De Greve,H., Read,J.S., Bourjolly,A. Ncube,l., Deboeck,F., Bouckaert,J. and Van Driessche,E.
 - TITLE  Purification, characterization and amino acid sequence of the seed lectinfrom Pterocarpusangolensis
 - JOURNAL Unpublished
 - REFERENCE 2 (bases 1 to 998)
 - AUTHORS De Greve,H.
 - TITLE Direct Submission
 - JOURNAL Submitted (20-DEC-2001) De Greve H., Genetische Virologie, Vrije Universiteit Brussel, Paardenstraat 65, Sint-Genesius-Rode, B-1640, BELGIUM
 - PUBMED  6827840

FEATURE

• Information about genes and gene products, as well as regions of biological significance reported in the sequence
• The featured codes for proteins and RNA models, as well as other features

Source

• This Mandatory feature in each record that summarizes the length of the sequence, scientific name of the source organism, and Taxon ID number
• Can also include other information such as map location, strain, clone, tissue type, etc., if provided by submitter

CDS

• Coding sequence
• Region of nucleotides that corresponds with the sequence of amino acids in a protein
• Location includes start and stop codons, and an amino acid translation takes place

Protein ID

• A protein sequence identification number, similar to the Version number of a nucleotide sequence
• Protein IDs consist of three letters followed by five digits, a dot, and a version number

Translation

• The amino acid translation corresponding to the nucleotide coding sequence (CDS)

ORIGIN

• The ORIGIN may be left blank, may appear as "Unreported," or may give a sequence data

Data Access

• Ensure you are clear what data you are searching for
• To find what you are looking for, link to all annotations for a particular query using most tools
• Portals are provided by both NCBI and EBI to allow searching across all databases with a single query

Popular Databases

• Genes: One stop resource for all annotation information for a gene
• PubMed: Extensive biomedical literature database
• Nucleotide: Database of all DNA sequence data
• dbSNP: Database of single nucleotide polymorphisms
• Protein: Database of protein sequences

Supplementary Popular Databases

• RefSeq: Comprehensive, integrated, well-annotated set of reference sequences (genomic, transcript, and protein)
• OMIM: Online Mendelian Inheritance in Man, with a database of human genes and genetic phenotypes
• ClinVar: a comprehensive database of genomic variation and the relationship to human health