Biology Class 13 Macromolecule Flashcards
7 Questions
100 Views

Choose a study mode

Play Quiz
Study Flashcards
Spaced Repetition
Chat to lesson

Podcast

Play an AI-generated podcast conversation about this lesson

Questions and Answers

Match the following macromolecule information:

Class of macromolecule = Protein Name of macromolecule's monomer subunit = Amino Acid What does R symbolize in this macromolecule = Side Group The name of the bond that connects the monomers = Peptide

What is the nucleotide sequence of the codon used to initiate protein synthesis?

AUG

All RNA is translated to generate proteins.

False (B)

When translated in a laboratory setting where translation can be initiated anywhere along the molecule, how many reading frames are possible for the sequence 5'—CAGAUCUAAUGCUUAUCGGAU—3'?

<p>3</p> Signup and view all the answers

According to the codon table, which amino acid sequence results from a synthetic 'poly-A' mRNA consisting only of A-bearing ribonucleotides?

<p>polylysine</p> Signup and view all the answers

Which of the following brings amino acids to the ribosome for use in translation?

<p>tRNA</p> Signup and view all the answers

What polypeptide would have been formed if a synthetic RNA that was poly-G (all guanine nucleotides) were used?

<p>glycine (Gly)</p> Signup and view all the answers

Study Notes

Macromolecules and Proteins

  • Proteins are a class of macromolecules essential for various biological functions.
  • The basic monomer unit of proteins is the amino acid.
  • The "R" in amino acids refers to the side group, which determines the characteristics of each amino acid.
  • Peptide bonds link amino acids together, forming polypeptides.

Protein Synthesis and Initiation

  • The codon that signals the start of protein synthesis is AUG.
  • Not all RNA is translated into proteins; some RNA types (e.g., rRNA, tRNA) serve other functions.

Central Dogma of Molecular Biology

  • The central dogma describes the flow of genetic information from DNA to RNA to protein.
  • A provided nucleotide sequence (5'—CAGAUCUAAUGCUUAUCGGAU—3') can generate three possible reading frames during translation experiments.

Codon Usage and Translation

  • A synthetic mRNA made only of adenine (5'-AAAAAA...AAAAAA-3') translates to the amino acid sequence known as polylysine.
  • Transfer RNA (tRNA) is responsible for transporting specific amino acids to the ribosome during the translation process.

Research and Synthetic RNA

  • Nirenberg and Matthaei conducted experiments that indicated if a synthetic RNA composed exclusively of guanine (poly-G) were used, it would result in the formation of the polypeptide glycine (Gly).

Studying That Suits You

Use AI to generate personalized quizzes and flashcards to suit your learning preferences.

Quiz Team

Description

This quiz focuses on the structure and classification of macromolecules, particularly proteins. It includes questions about their monomer subunits, bonds, and other fundamental concepts related to biochemistry. Test your knowledge with these flashcards that cover key definitions and terms in biology.

More Like This

Protein Macromolecules Overview
15 questions

Protein Macromolecules Overview

LionheartedDivisionism avatar
LionheartedDivisionism
Protein Macromolecules Structure Quiz
15 questions
Biochemistry: Macromolecules and Amino Acids
40 questions
Use Quizgecko on...
Browser
Browser