BIO273 Biology: The Genetic Code

• BIO273 Biology covers the genetic code

The Central Dogma

• DNA provides the information, RNA is a DNA copy and Ribosomes use RNA facts to make Proteins

Code

• A code converts information from one form to another
• To decode the following message you need to understand the code
• This is an Alphabet to number conversion of letters, A = 1, B = 2, ... Z = 26
• If the code is known, it can be translated between numbers and words

The Genetic Code

• A gene is a section of DNA that contains information needed to construct a protein
• Genetic code stores info sequentially using nucleotides
• Stored information are called Condons, words of three letters
• Every Codon refers to only one amino acid
• Amino Acids form proteins
• DNA dictates the arrangement of Amino Acids within any given Protein

Transcription

• Transcription generates an mRNA copy of a DNA sequence
• RNA uses Uracil instead of Thymine
• RNA uses Ribose instead of Deoxyribose
• These differences make RNA less stable then DNA
• To create RNA, the antisense strand of DNA serves as a Template
• DNA's Coding strand mirrors the mRNA sequence

Codons

• Words with three letters spells out the genetic code
• To get a nucleotide sequence into an amino acid, you need to find the sentence start and end
• The start codon is AUG in mRNA, and encodes for the amino acid Methionine
• UAA, UAG & UGA are stop codons in mRNA
• These DNA Codons includes TAA, TAG & TGA
• They do not code for any Amino Acids and halt building
• Codons dictate amino acid sequences

Open Reading Frame

• mRNA sequence helps determine Codons.
• Begins with the Start codon & ending in the Stop codon

Codon

• Each Codon contains three Nucleotides
• Nucleic Acids contain four Nucleotides (A, T, C, G)
• Codons can code for 43 = 64 Amino Acids
• Only 20 amino acids form Proteins
• Amino Acids can be encoded by multiple Codons
• The last Nucleotide can vary & code for a same Amino acid sequence

Genetic Code

• Every mRNA Codon corresponds to a specific Amino Acid
• Amino Acids are commonly represented with a 3-letter abbreviation

The Genetic Code

• Decoding open reading frames gives a sequence
• Proteins are created based on this sequence

Genetic Code for Oxytocin

• Coding strand duplicates mRNA
• Decoding mRNA creates this amino acid sequence: Met-Cys-Tyr-Ile-Gln-Asn-Cys-Pro-Leu-Gly

Protein Structure

• Sequence of Amino Acids forms the Primary structure
• Proteins fold after formation
• Secondary structure is the result of H-Bonding
• Creates a-helix or B-sheets
• Tertiary structure depends on Amino Acid interaction on the side chains
• Quaternary structure requires binding of 2+ polypeptide chains
• Structure of the Protein determines its purpose
• An altered Protein structure leads to either a non-functional Protein or one with a different function

Structure of Oxytocin

• Oxytocin is created by the hypothalamus and the pituitary gland
• It affects social bonding, sexual behavior, and childbirth
• Nonapeptide refers to the nine amino acids in question
• Initial Met is cleaved off for Met-Cys-Tyr-Ile-Gln-Asn-Cys-Pro-Leu-Gly or Cys-Tyr-Ile-Gln-Asn-Cys-Pro-Leu-Gly
• Formed by the two Cysteine acids using Disulfide Bonds
• Shown in yellow for main structure

Vasopressin

• Vasopressin is produced by the hypothalamus for Antidiuretic functions
• Genetic Code is similar to that of Oxytocin
• Contains two different nucleotides:
• Oxytocin includes ATGTGTTATATTCAAAATTGTCCTCTAGGTTAA
• whereas Vasopressin includes ATGTGTTATTTTCAAAATTGTCCTCGAGGTTAA
• Its Amino Acid sequence reads Met-Cys-Tyr-Phe-Gln-Asn-Cys-Pro-Arg-Gly

Structure & Function

• Very similar molecules exist but does two different functions
• Oxytocin is associated with Love, whereas, Vasopressin with Antidiuretic effects

The Genetic Code

• Nucleotide sequences are decoded by the genetic code
• All known Species are based on the same conserved code

Summary

• DNA has information stored in the sequence of Nucleotides
• Every Codon in DNA has three Nucleotides
• Each Codon codes for a unique Amino Acid
• Amino acid sequence comes from the sequence of Nucleotides
• In turn, the amino acid determines protein functions
• Change in Nucleotide sequences means this new protein:
• Has a different function
• Or becomes non-functional