Lecture 24 Chapter 24 Genes & Chromosomes Chapter 25 DNA Metabolism Chapter 26 RNA Metabolism PDF

Chapters 24-25 Universal Problem ’ Problem faced by all life and viruses DNA genome is so long 6 ’ How do you fit all of that DNA into each cell (or capsule)? ’ Humans  3.1 billion bp = 3,100,000,000 bp ’ DNA contained in 1 human cell = 2 meters long Super Coili...

Chapters 24-25 Universal Problem ’ Problem faced by all life and viruses DNA genome is so long 6 ’ How do you fit all of that DNA into each cell (or capsule)? ’ Humans  3.1 billion bp = 3,100,000,000 bp ’ DNA contained in 1 human cell = 2 meters long Super Coiling within ’c oll a coll Coiling of a coil = supercoiling like telephone ’ Structural hierarchy ’ Primary = sequence ’ Secondary = double helix ’ Tertiary = supercoiling ’ DNA = ‘underwinding’ http://www.bioinfo.org.cn/book/biochemistry/chapt23/799-1.jpg Chromatin - Eukaryotes ’ Consists of fibers containing protein and DNA in approximately equal proportions (by mass) and a small amount of RNA s a ’ Histones = proteins Dutwrapped r ’ Arg- & Lys-rich (25%) chromata primarily ↳ + charged a e ’ Nucleosomes = DNA and protein packages or structural units  * The L around ONA wrapped For more info, see: http://commonfund.nih.gov/epigenomics/ National Institutes of Health Human Chromosomes sex chromosome Figure from: “The New Genetics” National Institute of General Medical Sciences, NIH Genes ’ All the DNA that encodes the primary sequence of some final biological product ’ mRNA messenger &A ’ Protein ’ Includes those with structural and catalytic functions ’ Historically ’ Segment of DNA that controlled a phenotype RNA - translation To protein/enzyme ’ One gene – one enzyme hypothesis DNA I transcript. of. rep.. ’ One gene – one protein hypothesis Regulatory Sequences ’ DNA sequences ’ Provide the beginning or end of a gene ’ Influence transcription of genes T RNA is transcribed a translated, forming protun ’ Initiation points for transcription and/or replication Size ’ Chromosome = nucleic acid repository of genetic information ’ E. coli chromosome E. most simplest ’ Circular ’ 4,639,675 bp very big. ’ 4,300 genes for proteins ’ 157 genes for structural/catalytic RNA ’ Human chromosomes ’ Linear ’ 3.1 billion bp translated from bp the ’ 41,000 genes are ’ Spread throughout 24 different chromosomes  Viruses ’ Not free-living organisms but do contain genetic info. ’ Majority of biological researchers do not consider them living ’ For our class = NOT alive ’ Infectious parasites that use host machinery to replicate ’ Many consist of genome (DNA or RNA) surrounded by a protein coat ↓ affect bacta by DNA injecting daffeting Viral Genomes ’ RNA genome ’ Almost all plant viruses TMU ’ Some bacteria and animal viruses too ’ HIV (ssRNA)  9,000 nucleotides ’ Bacteriophage Qβ (ssRNA)  4,220 nucleotides ’ DNA genome ’ Many are circular for at least some part of cycle ’ Vary greatly in size ’ Bacteriophage λ  E. coli, circular double helix, 48,502 bp ’ Medium size DNA virus ’ Contour length = 17.5 μm ’ Prokaryotes are typically a few μm in maximum diameter Bacterial Genomes (E. coli) ’ Circular DNA Translation Cyto ’ 4,639,675 bp ’ Contour length of 1.7 mm ’ Cell is generally 1 x 2μm ’ May also contain various numbers of plasmids in cytosol emumt ’ A few thousand bp not too great , not too small - ’ Genes for own replication ’ Extra genes (antibiotic affect infection/antibiotis resistance) Bacterial Chromosomes ’ In general, bacteria Permiscuous contain only one - chromosome ’ Only one copy of their - genes ’ Almost all DNA  genes and regulatory sequences ’ Colinear with amino for lot of opp. acid or RNA sequence overlap btun prophase. redd blue it encodes f overlapping in diversity causing genetic Eukaryotic Genomes ’ Yeast cell ’ 2.6x more DNA than E. coli ’ Drosophila (awfug) ’ 35x more DNA than E. coli ’ Humans ’ 700x more DNA than E. coli ’ Many plants and amphibians contain much more  & wil pareur. Latest count = 41,000 -  Diploids ’ Genetic material of eukaryotes apportioned into chromosomes ’ Diploid number (2n) depends on the species ’ Humans = 46, or 23 pairs of chromosomes = 1 pair = sex ’ Each chromosome = single, large, duplex DNA molecule ’ 24 different human chromosomes vary in length over a 25-fold range ’ Each contains a characteristic set of genes - ’ DNA from one human genome would extend 1 meter ’ Most cells are diploid  2 meters of DNA ’ DNA in one human  2 x 1011 km would have to be wrapped around lightly on histone ’ Distance from earth to sun = 1.5 x 108 km Eukaryotic Organelles ’ Contain their own DNA ’ Mitochondria = power houses of cell ONA ’ mtDNA mitochondral ’ Circular duplex ’ 16,569 bp in humans ’ Contains 2-10 copies per cell ’ Chloroplasts = photosynthesis energy aganism ’ cpDNA greenb ny o ’ Circular duplex Eukaryotic Chromosomes ’ Structurally and functionally more complex ’ Only about 1.5% DNA codes for functional product ’ Genes contain one or more segments of DNA that do not code for amino acid of polypeptide product ’ Intervening sequences or introns ’ Coding segments = exons ’ Including introns, about 30% of DNA contains genes  genetic diversity Functional DNA in Humans Other DNA ’ Transposons = transposable elements  ‘jumping genes’ ’ Alu element (as much as 10% of human genome) ’ Simple sequence repeats (SSR) = highly repetitive ’ Simple sequence DNA, about 10 bp long ’ Centromere = sequence of DNA that functions during cell division as attachment point for proteins that link chromosome to mitotic spindle ’ About 130 bp long and A=T rich ’ Telomeres = sequences at the ends of the chromosome ’ Help stabilize chromosome  · dable u DNA Structure Review a AIT · 2 bands birn G, 3 bonds  notes ① chedcular Replication is Semiconservative ’ Conservative replication ’ Two ‘old’ strands together ’ Two ‘new’ strand together ’ Semiconservative replication ’ One ‘old’ and one ‘new’ strand - ↑ layer ’ Proposed by Watson & Crick double structure - ’ Proven in 1957, Meselson & Stahl ’ Using 15N & 14N tags ’ With 15N, 1% heavier ’ Centrifugation Replication Begins at an Origin ’ Cairns = Labeled E. coli DNA with 3H thymine ’ Radioactive, able to be tracked ’ Bi-directionally ’ Each strand replicated simultaneously ’ Replication bubble ’ Meet on the opposite side of the chromosome from the origin of replication (ori) - - http://www.uic.edu/classes/bios/bios100/lectures/bac-rep.jpg DNA Synthesis Only 5´  3´ ’ DNA polymerase can only add to the 3´ hydroxyl ’ Reads template 3´  5´ ’ Problem = how does replication proceed bi-directionally? ’ Semi-discontinuous ’ Leading strand ’ Lagging strand ’ Replicated in Okazaki fragments ’ Ligated together ↳ by ligase.  Overview of DNA Replication ’ Three stages: initiation, elongation, termination IET = - - ’ Helicase = ‘unzips’ the DNA a puche be dueto - ’ Topoisomerase = relieves topological stress ’ Primase = adds a short, RNA primer needed for: ’ DNA polymerase = adds complimentary nucleotide to the growing 3´ end of the chain, starting at the primer ’ Most organisms have many different forms ’ E. coli has five different forms ’ Different speed, different processivity, ‘specialties’, etc. ’ Many have ‘proof reading’ functions as well 5 diff mutations ’ Exonuclease > - can not cause anything ↳ targeting. rep PNA ’ E. coli = 4.6 x 106 bp, 1 mistake every 109-1010 ’ Equates to 1 mistake every 1000-10000 replications frequent but may cause some effects) not very , Replisome unzp  Step 1: Open the double helix Helicase 3’ Replication Bubble 5’ 5’ Replication Fork 3’  T+ U Step 2: Primase Makes a Short RNA - Primer inanalogosatementary - 3’ 5’ Primase 5’ 3’  Step 3: Replication of One Strand is Easy (Leading Strand) 3’ nameen 5’ 3’ 5’ 5’ 3’  Step 3: What Happens With The Other Strand? (Lagging Strand) 3’ 5’ 5’ 3’ 5’ 3’  Step 3: What Happens With The Other Strand? (Lagging Strand) 3’ 5’ Replication fork moves in this direction 5’ (S1 + 3) 3’ 5’ 3’  Step 3: What Happens With The Other Strand? (Lagging Strand) 3’ 5’ Replication fork moves in this direction 5’ 3’ antiparate dream 5’ 131+3) 3’ DNA polymerase has to move in this direction  Leading lagginga Answer: Okazaki Fragments 3’ conserver 5’ semi S Y 3’ = nep 5’ 5’ Dun 3’ I I 5’ 3’ 5’ 3’ I 5’ 3’ Step 4: Fragments Joined Together 3’ 5’ , Ches Hugem 5’ 3’ DNA Ligase 5’ 3’ DNA Polymerase ’ Can only add nucleotides in the 5’  3’ direction ’ Capable of proofreading ’ Different polymerases will have different proofreading abilities ’ Some are more accurate than others (higher fidelity)  to cleave break (neg. anages  cytosine to the WRs always exception Degradation ’ Nucleases = work on both DNA & RNA ’ DNases DNA enzyme that degrade RNase &NA degrade = ’ Exonucleases = only remove nucleotides from end > - outside of - ’ Only operate either 5´  3´ or 3´  5´, but not both - ’ Endonucleases = begin degradation at specific internal sites ’ Cuts into smaller & smaller pieces TATA ⑮ ’ Restriction endonucleases cut at specific sequences ’ Some only work on single-stranded DNA Mutations ’ Permanent change in DNA ’ Substitution ’ Insertion/deletion ’ Duplication ’ Linked to disease & cancer - ’ Ames test for mutagens Grow chicken meat http://upload.wikimedia.org/wikipedia/commons/th umb/6/6e/Ames_test.svg/500px-Ames_test.svg.png  DNA Repair ’ Very inefficient, bioenergetically speaking ’ Small price to pay to prevent mutations ’ Mismatch repair ’ Template methylated, distinguishable from new ↳ high UV Skin Cancer = break bonds · hydrogen strand ’ For a short period before it is methylated ’ E. coli and a few other bacteria  Base-Excision Repair ’ DNA glycosylases = cleave N- glycosyl bond ’ Apurinic or apyrimidinic site (AP site) ’ Sugar left behind is then removed & replaced with a new one ’ AP endonuclease removes a segment fixes it ’ Ligase seals the nick Nucleotide-Excision Repair ’ Large distortion in structures ’ E. coli cuts out 12 bases for 1 mistake and 13 for 2 ’ Eukaryotes cut out more ’ 27-29 http://www.atdbio.com/img/articles/nucleotide-excision-repair-large.png SOS Response  Desperation very dangerous ’ What happens when both strands are damaged? ’ Error-prone translesion DNA synthesis (TLS) Osuppose ’ Part of cell stress response to extensive DNA damage not ’ Special polymerases replicate past the " may be cell's lesion Stress response ’ Error rate 1 in 1000 ’ Other polymerases are incapable of replicating past a lesion on both strands  DNA Recombination ’ Homologous & site-specific recombination ’ Meiosis ’ Chromosome alignment  swap  genetic diversity ’ Transposable elements ’ One site to another, molecular parasites, evolutionary relics http://csls-text2.c.u-tokyo.ac.jp/images/fig/fig03_08.gif Chapter 26  Blending Inheritance ’ The idea that offspring would resemble an interim between the parental traits ’ Ex) If the parents are 5’10” and 6’0”, they can only have children between those heights DNAgene mplex & more ’ Not true: sister is 5’7” and brother is 6’4” ’ Additional theoretical problem…no more diversity - "Blending inheritance" by Squididdily at en.wikipedia. Licensed under CC BY-SA 3.0 via Commons - https://commons.wikimedia.org/wiki/File:Blending_inheritance.svg#/media/File:Blending_inheritance.svg  Gregor Johann Mendel 1822 – 1884 Augustinian monk Experimentalist and horticulturist Father of Genetics discovered a lot of themes Image from the: Deciphering the Genetic Code – NIH http://history.nih.gov/exhibits/nirenberg/HS1_mendel.htm  Model Organism: Pea Plants Image from wikimedia commons: http://en.wikipedia.org/wiki/File:Doperwt_rijserwt_peulen_Pisum_sativum.jpg  Studied 7 Traits Very lucky man! - - - - - - https://cnx.org/resources/fa6f545cec588d620656d63cefaa1ad4c528df03/Figure_08_01_03.jpg First Law: Law of Segregation ’ Specific factors are passed down from parent to offspring ’ These factors come in pairs ’ Offspring receive one from each parent ’ Some factors are dominant and others are recessive ’ One copy of a dominant factor is sufficient to give rise to the specific characteristic to which it is linked ’ In the presence of one copy of a dominant factor, a recessive factor can never express its corresponding trait Terminology ’ Gene = a region of DNA that encodes a functional RNA or protein product ’ Allele = a variant form of a gene ’ Example from pea plants YY ’ Gene = controls pea color ’ Yellow allele (dominant) = Y Yy ’ Green allele (recessive) = y yy Genotype vs. Phenotype ’ Genotype = the genetic makeup of an organism, with respect to a given characteristic ’ Ex) Pea color = YY, Yy, or yy ’ Homozygous = Both alleles are the same - ’ YY (homozygous dominant) or yy (homozygous recessive) ’ Heterozygous - = Two difference alleles ’ Yy ’ Phenotype = observed characteristic ’ Yellow ’ Green  Reginald C. Punnett ’ Devised an approach to predict the outcome of a cross-breeding experiment - ’ Usually focused on genotype http://www.dnaftb.org/images/5/5bio.gif  Punnette Square Genotype YY = 25% Phenotype Yellow = 75% Y y Yy = 50% Green = 25% yy = 25% Y YY Yy + Both heterozygous y Yy yy Yy + Yy  Punnette Square Genotype Yy = 50% Phenotype Yellow = 50% Y y yy = 50% Green = 50% y Yy yy + Heterozyg + Homozyg Recessive y Yy yy Yy + yy Law of Independent Assortment ’ Separate factors responsible for different traits are independently passed on from parents to offspring ’ For example: ’ We have looked at yellow vs. green peas ’ Mendel also looked at purple vs. white flowers ’ Yellow vs. green has no influence on flower color ’ They are inherited indepently of one another ~ Punnette Squares with Multiple Traits YYBb + YyBb Seed color (yellow and green) and Flower color (purple and white) YYBb YyBb Seed color: Seed color: Homozygous dominant Heterozygous Can only give ‘Y’ Can give ‘Y’ or ‘y’ Flower color: Flower color: Heterozygous Heterozygous Can give ‘B’ or ‘b’ Can give ‘B’ or ‘b’ Punnette Squares with multiple traits ’ YYBb YB YB Yb Yb ’ YB ’ YB YB YYBB YYBB YYBb YYBb ’ Yb ’ Yb ’ YyBb Yb YYBb YYBb YYbb YYbb ’ YB ’ Yb yB YyBB YyBB YyBb YyBb ’ yB ’ yb yb YyBb YyBb Yybb Yybb  Incomplete Dominance ’ Heterozygous offspring have a unique phenotype ’ Phenotype is a mix of that that would be seen in homozygous examples. ’ Flower color: RR ’ RR = red flower ’ WW = white flower ’ RW = pink flower RW ww  Co-Dominance ’& Both alleles are expressed ’ Examples: ’ Horse color: Roan ’ Both white and brown hairs are expressed ’ Human blood type: IA, IB, i ’ AB – IAIB ’ A – IAIA, IAi ’ B – IBIB, IBi ’ O – ii  Boveri-Sutton Chromosome Theory Theodore Boveri (1862-1915) Walter Sutton (1877-1916) German biologist American geneticist Images from wikimedia commons: http://en.wikipedia.org/wiki/File:Theodor_Boveri.jpg http://en.wikipedia.org/wiki/File:Walter_sutton.jpg Boveri-Sutton Chromosome Theory ’ Chromosomes are the cellular basis of Mendelian genetics ’ Hereditary information is stored in the chromosomes ’ The number of chromosomes is reduced to half during the production of gametes ’ Ova and sperm cells Cellular Basis of Mendelian Genetics? ’ The chromosomes ’ 23 PAIRS ’ 46 ’ 2 = sex ’ XX ’ XY Figure from: “The New Genetics”, National Institute of General Medical Sciences, NIH. http://publications.nigms.nih.gov/thenewgenetics/  RNA vs. DNA ’ Additional 2´ hydroxyl & use of U ’ Usually single-stranded ’ More structurally diverse ’ Only molecule info storage/ transmission & catalysis ’ RNA is transcribed from DNA ’ Exception: RNA-viruses ’ Transcriptome ’ mRNA, rRNA, tRNA, many others not in the classic categories RNA Polymerase ’ DNA-dependent RNA polymerase, DdRp ’ 5´  3´ ’ 3´ hydroxyl attacks the α Pi of incoming nucleotide ’ No use of primer, still uses topoisomerases ’ Binds to specific sequences  promoters ’ Transcription ‘bubble’ ’ 17 bp in E. coli, moves 50-90 nucleotides/sec ’ No intrinsic proofreading for most, error 1 in 104-105 ’ Some can reverse the reaction ’ Double-stranded DNA (dsDNA) ’ Template strand  used for transcription ’ Coding strand  directly corresponds to codon sequence -  Step 1: Open the double helix ’ Helicase – “unzips” the DNA double helix by breaking apart - the hydrogen bonds between complimentary base pairs. This forms the “transcription bubble.” * 3’ 5’ 5’ 3’  Step 2: RNA polymerase synthesizes the RNA compliment to the template strand I Template Strand 3’ - 5’ 5’ 3’ Coding Strand Step 3: Bonds between DNA template strand reform and new RNA leaves 5’ D 3’ UUGCGUUUACCAGAGCUAUAUUGCGCGCAUG Where to Start? Promoters ’ How do the RNA polymerases - know which is the template and where to start? - ’ RNA polymerases bind to DNA sequences called promoters - ’ Variable, but degree of conservation ’ ‘Consensus sequences’ ’ E. coli, extends -70 to +30 ’ 0  Transcription start site The Two Strands ’ Template strand of DNA ’ Serves as template for RNA synthesis/transcription ’ Will be antiparallel and complementary to mRNA ’ Coding strand of DNA ’ Does not serve as the template ’ Will be parallel and identical to new mRNA ’ All T will be U Where to End? Terminators ’ Transcription will continue until polymerase reaches specific sequences ’ Other proteins may also be involved in the termination RNA Polymerases in Eukaryotes ’ RNA polymerase I – synthesizes pre-ribosomal RNA - ’ RNA polymerase II – synthesizes messenger RNA as - well as some specialty RNA ’ RNA polymerase III – synthesizes transfer RNA and - other small, specialty RNA  Disruption of Transcription ’ Some antibiotics, actinomycin D ’ Intercalating agents ’ Insert themselves into double helix ’ Between successive G-C pairs ’ Prevents movement of RNA polymerase along double helix RNA Processing ’ Occurs with many bacterial RNA - ’ Occurs with almost all eukaryotic RNA - ’ Enzymes involved: & acts ’ RNA-based, ribozymes ’ Protein-based on the visonicles and - Katalyze specific reaction  Primary Transcript ’ Newly synthesized RNA molecule = primary transcript ’ Most extensive processing: ’ Eukaryotes: tRNA and mRNA ’ Prokaryotes: tRNA ’ For mRNA ’ Precursor-mRNA = pre-mRNA ’ Heterogeneous nuclear RNA (hnRNA) ’ Contains both introns and exons ’ RNA splicing removes introns pied  End Processing ’ Protection from degradation (ribonucleases) ’ 5´ cap added for protection ’ 7-methylguanosine ’ Sometimes residues 1 & 2 are methylated at 2´ ’ Participates in ribosome binding ’ Occurs after the first 20-30 nucleotides are added ’ 3´ end removed & poly(A) tail added (80-250 A) ’ Polyadenylate polymerase ’ Mature mRNA is final product ’ mRNA stable from a few sec to several cell - generations ’ Avg. for E. coli = 1.5 min ’ Avg. for vertebrates = 3 hour in evk tran prot a much longer  Introns & Exons ’ Both exons & introns are transcribed - ’ Most higher eukaryotic organisms introns int) ’ Some archaea, bacteria, & yeast ’ Exons ’ Most less than 1000 nucleotides ’ 100-200 range  30-60 amino acids ’ Introns ’ Vary in size from 50-20,000 nucleotides ’ Some genes have dozens of them Introns: Groups I and II ’ Group I ’ In nuclear, mitochondrial, and chloroplast genes that code for rRNAs, mRNAs, and tRNAs ’ Group II ’ In primary transcripts of mitochondrial or chloroplast mRNAs in fungi, algae, and plants ’ Group I and II also have been found in bacteria ’ Rare - ’ Do not require any high E cofactor (ATP) for splicing ’ Self-splicing Introns: Groups III and IV ’ Group III  Spliceosomal introns ’ Largest group ’ Nuclear mRNA primary transcripts ’ Uses spliceosome ’ Contains small nuclear RNAs (snRNA) ’ Group IV ’ Found in certain tRNAs ’ Requires ATP and an endonuclease  Differential mRNA Processing ’ Introns are always removed  rRNA & tRNA Processing ’ Pre-rRNA ’ May be modified at specific residues ’ May also contain introns ’ tRNA ’ Most cells have 40-50 distinct tRNAs ’ May also contain introns  Special RNA ’ Small nuclear RNA (snRNA) – processing, especially splicing ’ Small nucleolar RNA (snoRNA) – processing, especially methylation and/or pseudouridylation ’ Many are encoded in the introns of other genes ’ Micro RNA (miRNA) – regulation ’ Short, only 22 nucleotides long ’ Roughly 1% of genome https://nihdirectorsblog.files.wordpress.com/2013/11/mirna.jpg  Catalytic RNA = Ribozymes ’ Group I introns = self-splicing ’ RNase P = cleaves RNA (tRNA) ’ Contains a protein component as well ’ RNA viruses = self-cleavage ’ Virusoid – small RNA strand associated with plant virus ’ Ribosomes  rRNA = synthesis of proteins ’ Contains a protein component http://www.umich.edu/~caf lab/images/rnasepMec.gif Introduction to RNA Viruses ’ Genetic material in the form of RNA, & not DNA > ’ Usually ssRNA, can be dsRNA double randed ’ Retroviruses (HIV) = ssRNA single streused ’ Genome is around 10,000 nucleotides long ’ Need ssRNA  dsDNA, to be inserted into host genome by ’ Catalyzed Reverse transcriptase  RdDp (RNA Dependent DNA Polymerase) ’ HIV = 1-2 error every replication cycle ’ Often one long chain synthesized, then cut into separate proteins ’ gag & pol  cleaved into 6 separate proteins ’ Inner viral core (gag) / protease, integrase, RT (pol) ’ env  envelope ’ RT= huge tool in lab RNA  cDNA (complimentary)DNA ’ RNA replicase = RdRp  RNA replication ALK E RT is a Good Drug Target ’ 3’-Azido-2’,3’-dideoxy- thymidine (AZT)  Common Origin ’ Transposons, retroviruses, and introns ’ Transposons have structure similar to retroviruses ’ Retrotransposons ’ Encode a gene homologous to reverse transcriptase ’ In eukaryotes, they use an RNA - intermediate - ’ In prokaryotes, the DNA just jumps ’ Retrotransposons may be ‘evolutionary relics’ ’ Once a virus, but lost enveloping gene (defective) - ’ Forever trapped in the cell ↳ don't have why we specific treatment RNA & Biochemical Evolution ’ RNA World  RNA Stores info & catalyzes reactions ’ Ribozymes known today = sufficient to catalyze primordial metabolic system ’ Numerous RNA vestiges of RNA world ’ RNA viruses, retrotransposons, ribozymes ’ RNA catalyst responsible for protein synthesis ’ RNA catalyst with capacity for self-replication * ’ Prebiotic chemistry = rising field Boehr, D.D., et al. Current Opinion in Virology, 2014, 9:194-200 RNA-dependent RNA polymerase ’ RdRp ’ Responsible for genome duplication and maintenance in RNA viruses ’ Cycles through conformational changes while incorporating each nucleotide ’ Mutations can affect amino acid sequence and enzyme properties ’ Ex) G64S substitution  diminished virulence ’ Mice pre-treated with poliovirus (PV) carrying G64S RdRp immunoprotected against lethal wild-type (WT) Poliovirus ’ Picornaviridae ’ Protein capsid  icosahedral ’ 30 nm diameter ’ RNA genome and protein capsid ’ Single-stranded ’ Positive-sense (5’3’): can be directly translated ’ 7,500 nucleotides ’ Very simple, well-studied, good model  PV RdRp ’ Palm skets ’ Motifs A-E LEB ’ A & C contain absolutely conserved Asp residues highly charged ’ Coordinates two metal ions helping with phosphodiester bond formation ’ Thumb ’ Finger ’ F&G ’ Responsible for binding RNA template ’ D & F for NTP channel nucleonde http://www.pnas.org/content/101/13/4425/F3.large.jpg triphosphate  Structural Dynamics ’ Combination of NMR spectroscopy and MD simulations ’ Millisecond-timescale pre- and post-chemistry conformational changes ’ Formal checkpoints ’ Limits use of x-ray crystallography for reliable structures ’ Highly coordinated  anti- correlated ’ Template binding site ’ NTP binding site  Motif D ’ Measured chemical shift changes with NMR ’ Different conformational states (E:RNA & E:RNA:NTP) ’ Largest chemical shift change was for Met354 ’ Motif D ’ Lys359 is absolutely conserved ’ Suggested to act as general acid in mechanism ’ MD supported a conformational change in motif D upon NTP binding ’ Conformational change does not occur with incorrect nucleotide ’ Possible fidelity checkpoint Antiviral Strategies ’ RdRp = most conserved protein in RNA viral genome ’ Good antiviral target ’ Vaccines focus on manipulating error rate ’ K359R increases viral fidelity  attenuated virus ’ Almost as much immuno-protection as Sabin strain ’ D53N, Y73H, K250E, T362I ’ Absolutely conserved, good starting platform in other RNA viruses ’ Enterovirus, rhinovirus, hepatitis, Seneca Valley virus, cardiovirus ’ Information on conformational changes useful ’ Ability to manipulate them 1/25124