Genetic Engineering And Gene Therapy Fall 2024 PDF

Introduction to Genetic Engineering =================================== - No product or application is directly derived from it - Example: how microorganisms duplicate, exchange, and use their genetic information. Introduction to Genetic Engineering =================================== -...

Introduction to Genetic Engineering =================================== - No product or application is directly derived from it - Example: how microorganisms duplicate, exchange, and use their genetic information. Introduction to Genetic Engineering =================================== - **Applied science:** - Genetic manipulation of the transfer of genes between a farmer's two largest pigs so that only advantageous genes are selected - Utilizing DNA to identify a suspect in a crime. Introduction to Genetic Engineering =================================== - **Applied science (cont'd):** -- Examples: - Fixing the underlying genetic mutation to treat disease - Utilizing RNA regulatory molecules to permanently "fix" diseases. Tools and Techniques of Genetic Engineering ============================================ DNA: The Raw Material ===================== Enzymes for Splicing, Dicing, and Reversing Nucleic Acids --------------------------------------------------------- - **Restriction endonucleases:** - Clip DNA crosswise at selected positions - Recognize foreign DNA - Capable of breaking the phosphodiester bonds between adjacent nucleotides on both strands of - Protect bacteria and archaea from bacteriophage or plasmids. Dicing, and Reversing Nucleic Acids - Restriction endonucleases - Recognize and clip at **palindromes (**such as madam or racecar or the number 10801) Enzymes for Splicing, Dicing, and Reversing Nucleic Acids - **Sticky ends:** - Staggered symmetrical cuts that leave short tails - 4 -- 5 bases on each strand - Base-pair with complementary tails on other DNA fragments or plasmids Reversing Nucleic Acids ----------------------- **Ligase:** - Necessary to seal sticky ends together by rejoining the phosphate-sugar bonds cut by - Main application is final splicing of genes into plasmids and chromosomes Reversing Nucleic Acids ----------------------- - **Restriction fragments:** -- Pieces of DNA produced by restriction endonucleases - **Restriction fragment length polymorphisms** ### (RFLPs) - Differences in the cutting pattern of specific restriction endonucleases give rise to restriction patterns of different lengths - Allows direct comparison of DNA of two different organisms at a specific site. Reversing Nucleic Acids ----------------------- - **Reverse transcriptase:** - Replicates HIV and other retroviruses - Able to convert RNA into DNA - **Complementary DNA (cDNA):** - Made from messenger, transfer, ribosomal, and other forms of RNA - Useful in synthesizing eukaryotic genes from mRNA transcripts. - An intron is a region that resides within a gene but does not remain in the final mature mRNA molecule following transcription of that gene and does not code for amino acids that make up the protein encoded by that gene.   - **Gel electrophoresis:** - Produces a readable pattern of DNA fragments - Samples of DNA are placed in compartments in a soft agar gel and subjected to an electrical current - The negative charge on the phosphate groups cause the DNA to move toward the positive pole on the gel - The rate of movement of DNA through the gel is based on the size of the fragments. - Gel electrophoresis (cont'd): - Positions of DNA fragments are determined by staining the DNA fragments in the gel - Electrophoresis patterns are distinctive - Useful in characterizing DNA fragments - Allow for comparison of genetic similarities among samples in a genetic fingerprint.  Nucleic Acid Hybridization and Probes ------------------------------------- Gene Probes =========== - - - Gene Probes =========== Uses of gene probes: - Diagnosing the cause of an infection from a patient's specimen - Identifying a culture of an unknown bacterium or virus. - ATACGCATATACGGAGCTACAATTTACAGTACGAT - TATGCGTATATGCCTCGATGTTAAATGTCATGCTA Nucleic Acid Hybridization ========================== - Does not require electrophoresis - DNA is isolated, denatured, placed on an absorbent filter, and combined with a microbespecific probe - Blot is then developed and observed for areas of hybridization Nucleic Acid Hybridization ========================== Nucleic Acid Hybridization ========================== **Fluorescent *in situ* hybridization (FISH):** - Probes are applied to intact cells - Observed microscopically for the presence and location of specific genetic marker sequences on genes - A very effective way to identify genes on chromosomes - Also effective in identifying bacteria living in natural habitats without culturing them - Used to detect RNA in cells and tissues The Size of DNA =============== The relative sizes of nucleic acids are denoted by the number of base pairs (bp) they contain. - An average gene in *E. coli*: 1,300 bp or 1.3 kilobases - Entire genome of *E. coli*: 4,700,000 bp, 4,700 kilobases, or 4.7 megabases (Mb) - Epstein-Barr viruse: 172 kb - Human genome: 3.1 billion base pairs Polymerase Chain Reaction: A Molecular Xerox Machine ---------------------------------------------------- - Rapidly increases the amount of DNA in a sample without the need for making cultures or carrying out complex purification techniques. - Can replicate a target DNA from a few copies to billions of copies in a few hours - Sensitivity: - Can detect cancer from a single cell - Can diagnose an infection from a single gene copy - PCR uses the same events of DNA replication: - Opening of the double helix - Using the exposed strands as templates - Addition of primers - Action of DNA polymerase - Specialized ingredients used in PCR: - **Primers:** - synthetic oligonucleotides of a known sequence of 15 -- 30 bases that indicate where amplification should begin - **DNA polymerases:** - High temperatures necessitate use of DNA polymerases isolated from thermophilic bacteria. - PCR technique: - Utilizes a thermal cycler that automatically performs the cyclic temperature changes -- Three basic steps: - Denaturation - Priming - Extension -- Cyclic repetition of these steps amplifies the DNA Polymerase Chain Reaction ========================= - Real-time PCR: - Can detect products during the reaction instead of at the end - PCR can also be adapted to analyze RNA: - RNA is converted to DNA with reverse transcriptase Polymerase Chain Reaction ========================= PCR plays an essential role in: - Gene mapping - The study of genetic defects and cancer - Forensics - Infectious disease diagnosis - Taxonomy studies Polymerase Chain Reaction ========================= Methods in Recombinant DNA Technology: How to Imitate Nature ------------------------------------------------------------ - **Recombinant DNA technology:** - Deliberately removing genetic material from one organism and combine it with that of a different organism - Formation of genetic **clones** Methods in Recombinant DNA Technology - **Cloning:** - Removal of a selected gene from an animal, plant, or microorganism (genetic donor) - Propagation of that gene in a different host organism - Gene is inserted into a **vector** (a plasmid or virus) that will be inserted into a **cloning host** - Strategies for obtaining genes in an isolated state: - DNA is removed from cells and separated into fragments by endonucleases - Gene can be synthesized from isolated mRNA transcripts using reverse transcriptase (cDNA) - A gene can be amplified using PCR - **Genomic libraries:** - Genes maintained in a cloning host and vector, just like microbial pure culture - Collections of cDNA clones that represent the entire genome of numerous organisms Cloning Vectors =============== - Plasmids: - Small, well characterized, easy to manipulate - Can be transferred into appropriate host cells through transformation - Plasmids that carry genetic markers for resistance to antibiotics - Bacteriophage: - Have the natural ability to inject DNA into bacterial hosts through transduction Cloning Vectors =============== Important aspects of cloning vectors: - An origin of replication (ORI) so that it will be replicated by the DNA polymerase of the cloning host - Must accept DNA of the desired size - Typically contain a gene that confers drug resistance to their cloning host. Cloning Vectors =============== Cloning Hosts ============= Gene Therapy ============ For certain diseases, the disease phenotype is due to the lack of a single, specific protein. - Type I diabetes is causes by the lack of insulin - Insulin was first provided from the pancreas of pigs or cows - Recombinant human insulin was the first genetically engineered drug approved for humans Gene Therapy ============ **Gene therapy:** - - Gene Therapy ============ - - - Gene Therapy ============ Gene Therapy ============ Experimentation and clinical trials of gene testing: - - - - Gene Therapy ============ Germline gene therapy: - Genes are inserted into an egg, sperm, or early embryo - The new gene is present in all cells of the individual - Therapeutic gene is heritable DNA Technology as Genetic Medicine ---------------------------------- Diseases resulting from the inappropriate expression of a protein: -- Alzheimer's disease - Viral diseases - Many cancers DNA Technology as Genetic Medicine ----------------------------------