Escherichia Coli PDF

CLINICAL MICROBIOLOGY REVIEWS, Jan. 1998, p. 142–201 Vol. 11, No. 1 0893-8512/98/$04.0010 Copyright © 1998, American Society for Microbiology...

CLINICAL MICROBIOLOGY REVIEWS, Jan. 1998, p. 142–201 Vol. 11, No. 1 0893-8512/98/$04.0010 Copyright © 1998, American Society for Microbiology Diarrheagenic Escherichia coli JAMES P. NATARO* AND JAMES B. KAPER Center for Vaccine Development, Departments of Medicine, Pediatrics, and Microbiology & Immunology, University of Maryland School of Medicine, Baltimore, Maryland 21201 INTRODUCTION.......................................................................................................................................................144 ISOLATION AND IDENTIFICATION....................................................................................................................144 Biochemicals............................................................................................................................................................144 Serotyping................................................................................................................................................................144 Phenotypic Assays Based on Virulence Characteristics....................................................................................144 Molecular Detection Methods...............................................................................................................................145 Nucleic acid probes.............................................................................................................................................145 PCR.......................................................................................................................................................................147 COMMON THEMES IN E. COLI VIRULENCE...................................................................................................147 ENTEROTOXIGENIC E. COLI...............................................................................................................................147 Pathogenesis............................................................................................................................................................148 Heat-labile toxins................................................................................................................................................148 (i) LT-I.............................................................................................................................................................148 (ii) LT-II...........................................................................................................................................................149 Heat-stable toxins...............................................................................................................................................149 (i) STa..............................................................................................................................................................149 (ii) STb.............................................................................................................................................................151 Colonization factors............................................................................................................................................151 Epidemiology...........................................................................................................................................................152 Clinical Considerations..........................................................................................................................................153 Detection and Diagnosis........................................................................................................................................154 ENTEROPATHOGENIC E. COLI............................................................................................................................155 Pathogenesis............................................................................................................................................................155 Attaching-and-effacing histopathology.............................................................................................................155 Three-stage model of EPEC pathogenesis.......................................................................................................156 (i) Localized adherence..................................................................................................................................156 (ii) Signal transduction..................................................................................................................................156 (iii) Intimate adherence.................................................................................................................................158 Secreted proteins.................................................................................................................................................158 Locus of enterocyte effacement.........................................................................................................................159 Downloaded from https://journals.asm.org/journal/cmr on 22 November 2024 by 24.157.36.115. EAF plasmids......................................................................................................................................................159 Regulation............................................................................................................................................................160 Other potential virulence factors......................................................................................................................160 (i) Other fimbriae...........................................................................................................................................160 (ii) EAST1........................................................................................................................................................160 (iii) Invasion....................................................................................................................................................160 Mechanism of diarrhea......................................................................................................................................161 Epidemiology...........................................................................................................................................................161 Age distribution...................................................................................................................................................161 Transmission and reservoirs.............................................................................................................................161 EPEC in developed countries............................................................................................................................161 EPEC in developing countries..........................................................................................................................162 Clinical Considerations..........................................................................................................................................162 Detection and Diagnosis........................................................................................................................................162 Definition of EPEC.............................................................................................................................................162 Diagnostic tests...................................................................................................................................................163 (i) Phenotypic tests.........................................................................................................................................163 (ii) Genotypic tests.........................................................................................................................................163 * Corresponding author. Mailing address: Center for Vaccine De- velopment, Departments of Medicine and Pediatrics, University of Maryland School of Medicine, Baltimore, MD 21201. Phone: (410) 706-8442. Fax: (410) 706-6205. E-mail: [email protected]. 142 VOL. 11, 1998 DIARRHEAGENIC E. COLI 143 ENTEROHEMORRHAGIC E. COLI.......................................................................................................................164 Origins......................................................................................................................................................................164 Pathogenesis............................................................................................................................................................165 Histopathology.....................................................................................................................................................165 Shiga toxins.........................................................................................................................................................165 (i) Structure and genetics..............................................................................................................................165 (ii) Stx in intestinal disease..........................................................................................................................165 (iii) Stx in HUS...............................................................................................................................................167 EAST1...................................................................................................................................................................167 Enterohemolysin..................................................................................................................................................167 Intestinal adherence factors..............................................................................................................................167 pO157 plasmid....................................................................................................................................................168 Iron transport......................................................................................................................................................168 Other potential virulence factors......................................................................................................................168 Epidemiology...........................................................................................................................................................169 Incidence..............................................................................................................................................................169 Animal reservoir.................................................................................................................................................169 Transmission.......................................................................................................................................................169 Non-O157:H7 serotypes......................................................................................................................................170 Clinical Considerations..........................................................................................................................................171 Clinical disease...................................................................................................................................................171 Treatment.............................................................................................................................................................171 Vaccines................................................................................................................................................................172 Diagnosis and Detection........................................................................................................................................172 General considerations......................................................................................................................................172 (i) Why and when to culture.........................................................................................................................172 (ii) Biosafety issues.........................................................................................................................................173 (iii) Diagnostic methods.................................................................................................................................173 Culture techniques..............................................................................................................................................174 Immunoassays.....................................................................................................................................................174 (i) O and H antigens......................................................................................................................................174 (ii) Shiga toxins...............................................................................................................................................175 (iii) Other antigens.........................................................................................................................................175 (iv) Immunomagnetic separation.................................................................................................................175 (v) Free fecal cytotoxic activity.....................................................................................................................175 DNA probes and PCR........................................................................................................................................176 (i) Detection of stx genes................................................................................................................................176 (ii) Detection of eae genes..............................................................................................................................176 (iii) Detection of the pO157 plasmid/hemolysin gene................................................................................176 (iv) Detection of other genes.........................................................................................................................176 Downloaded from https://journals.asm.org/journal/cmr on 22 November 2024 by 24.157.36.115. Strain subtyping..................................................................................................................................................177 Serodiagnosis.......................................................................................................................................................177 ENTEROAGGREGATIVE E. COLI.........................................................................................................................178 Pathogenesis............................................................................................................................................................178 Histopathology.....................................................................................................................................................178 Adherence.............................................................................................................................................................179 EAST1...................................................................................................................................................................179 Invasiveness.........................................................................................................................................................179 Cytotoxins............................................................................................................................................................179 Model of EAEC pathogenesis............................................................................................................................179 Epidemiology...........................................................................................................................................................180 Clinical Features.....................................................................................................................................................181 Detection and Diagnosis........................................................................................................................................181 HEp-2 assay.........................................................................................................................................................181 DNA probe...........................................................................................................................................................181 Other tests for EAEC.........................................................................................................................................182 ENTEROINVASIVE E. COLI....................................................................................................................................182 Pathogenesis............................................................................................................................................................182 Invasiveness.........................................................................................................................................................182 Enterotoxin production......................................................................................................................................182 Epidemiology...........................................................................................................................................................182 Clinical Considerations..........................................................................................................................................183 Detection and Diagnosis........................................................................................................................................183 DIFFUSELY ADHERENT E. COLI.........................................................................................................................183 Pathogenesis............................................................................................................................................................184 Epidemiology...........................................................................................................................................................184 144 NATARO AND KAPER CLIN. MICROBIOL. REV. Clinical Features.....................................................................................................................................................184 Detection and Diagnosis........................................................................................................................................184 OTHER CATEGORIES OF E. COLI WHICH ARE POTENTIALLY DIARRHEAGENIC.............................185 CONCLUSIONS.........................................................................................................................................................185 ACKNOWLEDGMENTS...........................................................................................................................................185 REFERENCES............................................................................................................................................................186 INTRODUCTION methylene-blue agar, which selectively grow members of the Enterobacteriaceae and permit differentiation of enteric organ- Escherichia coli is the predominant facultative anaerobe of isms on the basis of morphology (32). the human colonic flora. The organism typically colonizes the Enterobacteriaceae are usually identified via biochemical re- infant gastrointestinal tract within hours of life, and, thereaf- actions. These tests can be performed in individual culture ter, E. coli and the host derive mutual benefit (169). E. coli tubes or by using test “strips” which are commercially avail- usually remains harmlessly confined to the intestinal lumen; able. Either method produces satisfactory results. however, in the debilitated or immunosuppressed host, or For epidemiologic or clinical purposes, E. coli strains are when gastrointestinal barriers are violated, even normal “non- often selected from agar plates after presumptive visual iden- pathogenic” strains of E. coli can cause infection. Moreover, tification. However, this method should be used only with even the most robust members of our species may be suscep- caution, because only about 90% of E. coli strains are lactose tible to infection by one of several highly adapted E. coli clones positive; some diarrheagenic E. coli strains, including many of which together have evolved the ability to cause a broad spec- the EIEC strains, are typically lactose negative. The indole trum of human diseases. Infections due to pathogenic E. coli test, positive in 99% of E. coli strains, is the single best test for may be limited to the mucosal surfaces or can disseminate differentiation from other members of the Enterobacteriaceae. throughout the body. Three general clinical syndromes result from infection with inherently pathogenic E. coli strains: (i) Serotyping urinary tract infection, (ii) sepsis/meningitis, and (iii) enteric/ diarrheal disease. This article will review the diarrheagenic E. Serotyping of E. coli occupies a central place in the history of coli strains, which include several emerging pathogens of these pathogens (reviewed in reference 394. Prior to the iden- worldwide public health importance, and will specifically focus tification of specific virulence factors in diarrheagenic E. coli on pathogens afflicting humans. We will particularly concen- strains, serotypic analysis was the predominant means by which trate on the E. coli strains whose study has advanced most over pathogenic strains were differentiated. In 1933, Adam showed the last decade, i.e., enteropathogenic E. coli (EPEC), entero- by serologic typing that strains of “dyspepsiekoli” could be hemorrhagic E. coli (EHEC), and enteroaggregative E. coli implicated in outbreaks of pediatric diarrhea. In 1944, Kauff- (EAEC). Since the categories of diarrheagenic E. coli are dif- man proposed a scheme for the serologic classification of E. ferentiated on the basis of pathogenic features, emphasis will coli which is still used in modified form today. be placed on the mechanisms of disease and the development According to the modified Kauffman scheme, E. coli are of diagnostic techniques based on virulence factors. serotyped on the basis of their O (somatic), H (flagellar), and K (capsular) surface antigen profiles (185, 394). A total of 170 different O antigens, each defining a serogroup, are recognized ISOLATION AND IDENTIFICATION currently. The presence of K antigens was determined origi- Although assays to identify all categories of diarrheagenic E. nally by means of bacterial agglutination tests: an E. coli strain Downloaded from https://journals.asm.org/journal/cmr on 22 November 2024 by 24.157.36.115. coli are available, in many situations it is not necessary to that was inagglutinable by O antiserum but became aggluti- implicate a specific E. coli pathogen in a particular patient. nable when the culture was heated was considered to have a K Patients with enterotoxigenic E. coli (ETEC) traveler’s diar- antigen. The discovery that several different molecular struc- rhea, for example, generally resolve their diarrhea long before tures, including fimbriae, conferred the K phenotype led ex- they come to medical attention for stool culture. Most entero- perts to suggest restructuring the K antigen designation to invasive E. coli (EIEC) isolates will be missed in the clinical include only acidic polysaccharides (394). Proteinaceous fim- laboratory, yet diarrhea generally resolves and patients re- brial antigens have therefore been removed from the K series spond to empirical antibiotics, such as fluoroquinolones, given and have been given F designations (494). for other bacterial diarrheas. Culturing stools for most catego- A specific combination of O and H antigens defines the ries of diarrheagenic E. coli should be performed in cases of “serotype” of an isolate. E. coli of specific serogroups can be persistent diarrhea, especially in travelers, children and the associated reproducibly with certain clinical syndromes (Table immunocompromised, as well as in outbreak situations. E. coli 1), but it is not in general the serologic antigens themselves can be isolated from the stool and sent to a qualified reference that confer virulence. Rather, the serotypes and serogroups laboratory for definitive identification. The indications for cul- serve as readily identifiable chromosomal markers that corre- turing for EHEC differ from those for the rest of the diarrhea- late with specific virulent clones (690). genic E. coli categories; indications for culturing EHEC are discussed below in greater detail in the EHEC section. Phenotypic Assays Based on Virulence Characteristics Identification of diarrheagenic E. coli strains requires that Biochemicals these organisms be differentiated from nonpathogenic mem- E. coli is the type species of the genus Escherichia, which bers of the normal flora. Serotypic markers correlate, some- contains mostly motile gram-negative bacilli within the family times very closely, with specific categories of diarrheagenic E. Enterobacteriaceae and the tribe Escherichia (55, 185). coli; however, these markers are rarely sufficient in and of E. coli can be recovered easily from clinical specimens on themselves to reliably identify a strain as diarrheagenic. (An general or selective media at 37°C under aerobic conditions. E. exception may be strains of serotype O157:H7, a serotype that coli in stool are most often recovered on MacConkey or eosin serves as a marker for virulent enterohemorrhagic E. coli VOL. 11, 1998 DIARRHEAGENIC E. COLI 145 TABLE 1. Serotypes characteristic of the diarrheagenic diarrheagenic E. coli is the HEp-2 adherence assay. The E. coli categories method has recently been reviewed in detail (160). This assay Category Serogroup Associated H antigen(s) was first described in 1979 by Cravioto et al. (139) and remains the “gold standard” for the diagnosis of EAEC and diffusely ETEC O6 H16 adherent E. coli (DAEC). The HEp-2 assay has been modified O8 H9 often since its first description, including such variations as O11 H27 extending the incubation time to 6 h or changing the growth O15 H11 medium during the incubation. However, collaborative studies O20 NM O25 H42, NM have shown that the assay performed essentially as first de- O27 H7 scribed provides the best ability to differentiate among all three O78 H11, H12 adherent diarrheagenic categories (EPEC, EAEC, and O128 H7 DAEC) (678). The HEp-2 adherence assay entails inoculating O148 H28 the test strain onto a semiconfluent HEp-2 monolayer and O149 H10 incubating it for 3 h at 37°C under 5% CO2. After this incu- O159 H20 bation time, the monolayer is washed, fixed, stained, and ex- O173 NM amined by oil immersion light microscopy. The three patterns of HEp-2 adherence (Fig. 1), localized adherence (LA), aggre EPEC O55 H6, NM O86 H34, NM gative adherence (AA), and diffuse adherence (DA), can be O111 H2, H12, NM differentiated reliably by an experienced technician. However, O119 H6, NM the authors have found some strains which yield equivocal O125ac H21 results reproducibly in the HEp-2 assay. O126 H27, NM O127 H6, NM Molecular Detection Methods O128 H2, H12 O142 H6 Diarrheagenic E. coli strains were among the first pathogens for which molecular diagnostic methods were developed. In- EHEC O26 H11, H32, NM O55 H7 deed, molecular methods remain the most popular and most O111ab H8, NM reliable techniques for differentiating diarrheagenic strains O113 H21 from nonpathogenic members of the stool flora and distin- O117 H14 guishing one category from another. Substantial progress has O157 H7 been made both in the development of nucleic acid-based probe technologies as well as PCR methods. EAEC O3 H2 Nucleic acid probes. The use of DNA probes for detection O15 H18 of heat-labile (LT) and heat-stable (ST) enterotoxins in ETEC O44 H18 revolutionized the study of these organisms, replacing cumber- O86 NM O77 H18 some and costly animal models of toxin detection (455). Since O111 H21 then, gene probes have been introduced for all diarrheagenic O127 H2 categories. Two general methods are commonly used for nu- O?a H10 cleic acid probe specimen preparation. The first entails the inoculation of purified cultures onto agar plates to produce Downloaded from https://journals.asm.org/journal/cmr on 22 November 2024 by 24.157.36.115. EIEC O28ac NM “colony” blots, in which 30 to 50 such cultures are inoculated O29 NM per plate. After incubation, the bacterial growth is transferred O112ac NM to nitrocellulose or Whatman filter paper for hybridization O124 H30, NM (alternatively, the cultures can be grown directly on the nitro- O136 NM O143 NM cellulose overlying an agar plate). The bacterial growth on the O144 NM paper can be lysed, denatured, and hybridized with the probe O152 NM in situ, and then a radiographic image is generated by exposure O159 H2, NM to X-ray film. Substantial experience by ourselves and others O164 NM has demonstrated that the colony blot method is reliable and O167 H4, H5, NM efficient. However, the use of this method requires that the E. a O antigen untypeable by conventional methods. coli strain first be isolated from the patient’s stool, which in- troduces the possibility that any number of E. coli colonies picked from a stool culture may fail to yield the offending pathogenic strain. Over several years of study, we have found strains; nevertheless, EHEC of serotypes other than O157:H7 that patients symptomatic with E. coli diarrhea generally are being identified with increasing frequency in sporadic and present with the pathogenic strain as their predominant E. coli epidemic cases.) In addition to its limited sensitivity and spec- strain in the flora. Thus, studies in which three E. coli isolates ificity, serotyping is tedious and expensive and is performed are tested per diarrheal stool specimen will have acceptable reliably only by a small number of reference laboratories. Thus, sensitivity. If increased sensitivity is desired or if the study detection of diarrheagenic E. coli has focused increasingly on entails a large number of asymptomatic patients, isolating five the identification of characteristics which themselves deter- isolates per specimen may be more appropriate. mine the virulence of these organisms. This may include in An alternative to the use of colony blots is the stool blot vitro phenotypic assays which correlate with the presence of method. In this technique, stool samples are spotted directly specific virulence traits or detection of the genes encoding onto nitrocellulose filters that have been overlaid onto an agar these traits. plate (373). After overnight incubation, the filter paper is One of the most useful phenotypic assays for the diagnosis of peeled off the plate, air dried, and treated as above for colony  146 Downloaded from https://journals.asm.org/journal/cmr on 22 November 2024 by 24.157.36.115. VOL. 11, 1998 DIARRHEAGENIC E. COLI 147 blots. The advantages of this technique include (i) that the E. varieties. However, diarrheagenic E. coli strains possess spe- coli colonies need not be isolated from the stool and (ii) that cific fimbrial antigens that enhance their intestinal colonizing there may be increased sensitivity if the pathogenic strain rep- ability and allow adherence to the small bowel mucosa, a site resents a minority member of the flora. However, the presence that is not normally colonized (389, 679). The various mor- of large numbers of other bacteria decreases the sensitivity of phologies of E. coli fimbriae are illustrated in Fig. 2. The role this test, and a threshold number (ca. 105 to 106 per g of stool of fimbrial structures in adherence and colonization is often ) of pathogenic organisms must be present to yield defin- inferred rather than demonstrated, in part due to the host itive results. In addition, the use of stool blots alone does not specificity of most fimbrial adhesins. result in a pure culture of the pathogen, which may be required Once colonization is established, the pathogenetic strategies for verification of phenotypes. of the diarrheagenic E. coli strains exhibit remarkable variety. Nucleic acid-based probes themselves can be of two types: Three general paradigms have been described by which E. coli oligonucleotide or polynucleotide (fragment probes). DNA may cause diarrhea; each is described in detail in the appro- fragment (polynucleotide) probes may be derived from genes priate section below: (i) enterotoxin production (ETEC and that encode a particular phenotype or may instead be empirical EAEC), (ii) invasion (EIEC), and/or (iii) intimate adherence probes which, through extensive testing, are found to be linked with membrane signalling (EPEC and EHEC). However, the with the presence of a phenotype. Although empirical probes interaction of the organisms with the intestinal mucosa is spe- have generated useful results (41, 701), probes which represent cific for each category. Schematized paradigms are illustrated the virulence genes themselves are generally superior (241). in Fig. 3. Oligonucleotide probes are derived from the DNA sequence of a target gene. Annealing temperatures and other conditions The versatility of the E. coli genome is conferred mainly by of hybridization and washing need to be determined much two genetic configurations: virulence-related plasmids and more precisely than for polynucleotide probes. Moreover, very chromosomal pathogenicity islands. All six categories of diar- slight strain-to-strain differences among the virulence genes rheagenic E. coli described in this review have been shown to may generate false-negative results with oligonucleotide carry at least one virulence-related property upon a plasmid. probes. Nevertheless, oligonucleotide probes have the advan- EIEC, EHEC, EAEC, and EPEC strains typically harbor tage of faster and often cleaner results than those generated by highly conserved plasmid families, each encoding multiple vir- polynucleotide methods, a factor that comes into play espe- ulence factors (275, 467, 701). McDaniel and Kaper have cially when screening for very small genes. Recommended shown recently that the chromosomal virulence genes of EPEC oligonucleotide probes are listed in Table 2. and EHEC are organized as a cluster referred to as a patho- Whereas the original probe techniques involved radionucle- genicity island (431, 432). Such islands have been described for otides to detect probe hybridization, nonisotopic methods are uropathogenic E. coli strains (163) and systemic E. coli strains becoming more popular. These include several methods for (75) as well and may represent a common way in which the tagging oligonucleotide probes and a smaller number of effec- genomes of pathogenic and nonpathogenic E. coli strains di- tive techniques for detection of polynucleotide probes. These verge genetically. Plasmids and pathogenicity islands carry nonisotopic techniques have facilitated the introduction of clusters of virulence traits, yet individual traits may be trans- probe technology into areas where the use of radioisotopes poson encoded (such as ST) (607) or phage encoded (such as is impractical. Shiga toxin) (485). PCR. PCR is a major advance in molecular diagnostics of In the sections that follow, we will review all aspects of pathogenic microorganisms, including E. coli. PCR primers disease due to the different classes of diarrheagenic E. coli. have been developed successfully for several of the categories Since diarrheagenic E. coli strains are distinguished and de- Downloaded from https://journals.asm.org/journal/cmr on 22 November 2024 by 24.157.36.115. of diarrheagenic E. coli (listed in Table 2). Advantages of PCR fined on the basis of pathogenetic mechanisms, much of this include great sensitivity in in situ detection of target templates. review will concern the latest advances in our knowledge of the However, substances within stools have been shown to inter- pathogenesis of these organisms. fere with the PCR, thus decreasing its sensitivity (615); several methods have been used successfully to remove such inhibi- tors, including Sepharose spin column chromatography and ENTEROTOXIGENIC E. COLI adsorption of nucleic acids onto glass resin (397, 615). Scru- pulous attention to proper technique must be maintained to ETEC is defined as containing the E. coli strains that elab- avoid carryover of PCR products from one reaction to the next. orate at least one member of two defined groups of enterotox- ins: ST and LT (381). ETEC strains were first recognized as COMMON THEMES IN E. COLI VIRULENCE causes of diarrheal disease in piglets, where the disease con- Like most mucosal pathogens, E. coli can be said to follow a tinues to cause lethal infection in newborn animals (reviewed requisite strategy of infection: (i) colonization of a mucosal in reference 15). Studies of ETEC in piglets first elucidated the site, (ii) evasion of host defenses, (iii) multiplication, and (iv) mechanisms of disease, including the existence of two plasmid- host damage. The most highly conserved feature of diarrhea- encoded enterotoxins. The first descriptions of ETEC in hu- genic E. coli strains is their ability to colonize the intestinal mans reported that certain E. coli isolates from the stools of mucosal surface despite peristalsis and competition for nutri- children with diarrhea elicited fluid secretion in ligated rab- ents by the indigenous flora of the gut (including other E. coli bit intestinal loops (642). DuPont et al. subsequently showed strains). The presence of surface adherence fimbriae is a prop- that ETEC strains were able to cause diarrhea in adult erty of virtually all E. coli strains, including nonpathogenic volunteers (175). FIG. 1. The three HEp-2 adherence patterns manifested by diarrheagenic E. coli. (A) Localized adherence (LA), typical of EPEC. Bacteria form characteristic microcolonies on the surface of the HEp-2 cell. (B) Aggregative adherence (AA), which defines EAEC. Bacteria adhere to each other away from the cells as well as to the cell surface in a characteristic stacked-brick configuration. (C) Diffuse adherence (DA), which defines DAEC. Bacteria are dispersed over the surface of the cell. 148 NATARO AND KAPER CLIN. MICROBIOL. REV. TABLE 2. Nucleotide sequences of PCR oligonucleotide primers and oligonucleotide probes for diarrheagenic E. coli strains Category Factor PCR oligonucleotidesa Reference Oligonucleotide probe Reference ETEC STI TTAATAGCACCCGGTACAAGCAGG 492 GCTGTGAATTGTGTTGTAATCC 457 CTTGACTCTTCAAAAGAGAAAATTAC GCTGTGAACTTTGTTGTAATCC LT GGCGACAGATTATACCGTGC 581 GCGAGAGGAACACAAACCGG 581 CCGAATTCTGTTATATATGTC EPEC eae —b EAF CAGGGTAAAAGAAAGATGATAA 214 TATGGGGACCATGTATTATCA 313 TATGGGGACCATGTATTATCA BFP AATGGTGCTTGCGCTTGCTGC 268 GCTACGGTGTTAATATCTCTGGCG 462 GCCGCTTTATCCAACCTGGTA EHEC eae CAGGTCGTCGTGTCTGCTAAA 234 ACTGAAAGCAAGCGGTGGTG 691 TCAGCGTGGTTGGATCAACCT (O157:H7-specific) SLTI TTTACGATAGACTTCTCGAC 223 GATGATCTCAGTGGGCGTTC 270 CACATATAAATTATTTCGCTC (SLT-I AND II) SLTII As above TCTGAAACTGCTCCTGTGTA 270 Plasmid ACGATGTGGTTTATTCTGGA 223 CCGTATCTTATAATAAGACGGATGTTGG 223 CTTCACGTCACCATACATAT EIEC ial CTGGATGGTATGGTGAGG 579 CCATCTATTAGAATACCTGTG 579 GGAGGCCAACAATTATTTCC EAEC Plasmid CTGGCGAAAGACTGTATCAT 576 None CAATGTATAGAAATCCGCTGTT a Each primer is written 59-39. See the text for abbreviations and discussion. b No oligonucleotide primers have yet been described which will detect specifically all human EPEC strains. (See reference 234.) Pathogenesis (Fig. 4A) (622). The B subunits are arranged in a ring or “doughnut” and bind strongly to the ganglioside GM1 and ETEC strains are generally considered to represent a patho- weakly to GD1b and some intestinal glycoproteins (643). The genic prototype: the organisms colonize the surface of the A subunit is responsible for the enzymatic activity of the toxin Downloaded from https://journals.asm.org/journal/cmr on 22 November 2024 by 24.157.36.115. small bowel mucosa and elaborate their enterotoxins, giving and is proteolytically cleaved to yield A1 and A2 peptides rise to a net secretory state. Some investigators have reported joined by a disulfide bond. Two closely related variants of LT-I that ETEC strains may exhibit limited invasiveness in cell cul- which exhibit partial antigenic cross-reactivity have been de- tures, but this has not been demonstrated in vivo (189, 190). scribed. These variants are called LTp (LTp-I) and LTh ETEC strains cause diarrhea through the action of the en- (LTh-I) after their initial discovery in strains isolated from pigs terotoxins LT and ST. These strains may express an LT only, or humans, respectively. The genes encoding LT (elt or etx) an ST only, or both an LT and an ST. These toxins have reside on plasmids that also may contain genes encoding ST recently been reviewed (291, 293, 295, 296, 480, 589), and the and/or colonization factor antigens (CFAs). reader is referred to these sources for primary references. After binding to the host cell membranes, the toxin is endo- Heat-labile toxins. The LTs of E. coli are oligomeric toxins cytosed and translocated through the cell in a process involving that are closely related in structure and function to the cholera enterotoxin (CT) expressed by Vibrio cholerae (596). LT and trans-Golgi vesicular transport (378). The cellular target of LT CT share many characteristics including holotoxin structure, is adenylate cyclase located on the basolateral membrane of protein sequence (ca. 80% identity), primary receptor identity, polarized intestinal epithelial cells. The A1 peptide has an enzymatic activity, and activity in animal and cell culture as- ADP-ribosyltransferase activity and acts by transferring an says; some differences are seen in toxin processing and secre- ADP-ribosyl moiety from NAD to the alpha subunit of the tion and in helper T-lymphocyte responses (153). There are GTP-binding protein, GS, which stimulates adenylate cyclase two major serogroups of LT, LT-I and LT-II, which do not activity. ADP-ribosylation of the GSa subunit results in ade- cross-react immunologically. LT-I is expressed by E. coli strains nylate cyclase being permanently activated, leading to in- that are pathogenic for both humans and animals. LT-II is creased levels of intracellular cyclic AMP (cAMP). cAMP- found primarily in animal E. coli isolates and rarely in human dependent protein kinase (A kinase) is thereby activated, isolates, but in neither animals nor humans has it been asso- leading to supranormal phosphorylation of chloride channels ciated with disease. Unless otherwise distinguished by Roman located in the apical epithelial cell membranes. The major numerals, the term LT below refers to the LT-I form. chloride channel activated by LT and CT is CFTR (589), the (i) LT-I. LT-I is an oligomeric toxin of ca. 86 kDa composed ion channel that is defective in cystic fibrosis. The net result is of one 28-kDa A subunit and five identical 11.5-kDa B subunits stimulation of Cl2 secretion from secretory crypt cells and VOL. 11, 1998 DIARRHEAGENIC E. COLI 149 inhibition of NaCl absorption by villus tip cells. The increased GM1 (229). As noted above, there is no evidence that LT-II is luminal ion content draws water passively through the para- associated with human or animal disease. cellular pathway, resulting in osmotic diarrhea. Heat-stable toxins. In contrast to the large, oligomeric LTs, Although the stimulation of Cl2 as a result of increased the STs are small, monomeric toxins that contain multiple intracellular levels of cAMP is the classical explanation for the cysteine residues, whose disulfide bonds account for the heat mechanism by which LT and CT cause diarrhea, there is in- stability of these toxins. There are two unrelated classes of STs creasing evidence, obtained mostly with CT, that the secretory that differ in structure and mechanism of action. Genes for response to these toxins is considerably more complex (re- both classes are found predominantly on plasmids, and some viewed in reference 589). One alternative mechanism by which ST-encoding genes have been found on transposons. STa (also these toxins could act involves prostaglandins of the E series called ST-I) toxins are produced by ETEC and several other (PGE1 and PGE2) and platelet-activating factor. Synthesis and gram-negative bacteria including Yersinia enterocolitica and V. release of arachidonic acid metabolites such as prostaglandins cholerae non-O1. STa has about 50% protein identity to the and leukotrienes can stimulate electrolyte transport and intes- EAST1 ST of EAEC, which is described further below. It has tinal motility. A second alternative mechanism involves the recently been reported (564, 706) that some strains of ETEC enteric nervous system (ENS), which regulates intestinal mo- may also express EAST1 in addition to STa. STb has been tility and ion secretion. Serotonin and vasoactive intestinal found only in ETEC. polypeptide, both of which can stimulate intestinal epithelial (i) STa. The mature STa is an 18- or 19-amino-acid peptide cell secretion via the ENS, are released into the human small with a molecular mass of ca. 2 kDa. There are two variants, bowel after treatment with CT (186). A third potential mech- designated STp (ST porcine or STIa) and STh (ST human or anism could involve a mild intestinal inflammatory response STIb), after their initial discovery in strains isolated from pigs due to CT and LT. CT has been reported to stimulate produc- or humans, respectively. Both variants can be found in human tion of the proinflammatory cytokine interleukin-6 (IL-6), ETEC strains. These two variants are nearly identical in the 13 thereby activating the enteric immune system and potentially residues that are necessary and sufficient for enterotoxic activ- generating arachidonic acid metabolites that stimulate secre- ity, and of these 13 residues, 6 are cysteines which form three tion (433). These alternative secretory mechanisms are sup- intramolecular disulfide bonds. STa is initially produced as a ported by a variety of in vitro and in vivo data, and one or more 72-amino-acid precursor (pre-pro form) that is cleaved by sig- of them could act in concert with the classic mode of action nal peptidase 1 to a 53-amino-acid peptide (533). This form is involving cAMP in causing diarrhea due to LT and CT. The transported to the periplasm, where the disulfide bonds are similarity of LT and CT is considered sufficiently high to ex- formed by the chromosomally encoded DsbA protein (708). trapolate mechanistic similarities between the two toxins, and An undefined protease processes the pro-STa to the final 18- the validity of these assumptions has proven largely correct, or 19-residue mature toxin which is released by diffusion across with the exception of the failure of LT to release serotonin the outer membrane. (660). However, observations made to date for secondary ef- The major receptor for STa is a membrane-spanning enzyme fects of CT have not all been demonstrated for LT, nor has the called guanylate cyclase C (GC-C), which belongs to a family clinical relevance of these secondary secretory effects been of receptor cyclases that includes the atrial natriuretic peptide substantiated. receptors GC-A and GC-B (152, 670). Additional receptors for CT and LT have been shown as well to decrease the absorp- STa may exist (292, 410), but GC-C is the only receptor iden- tion of fluid and electrolytes from the intestinal lumen (200). tified definitively. GC-C is located in the apical membrane of Muller et al. have reported that both CT and LT induce intestinal epithelial cells, and binding of ligands to the extra- Downloaded from https://journals.asm.org/journal/cmr on 22 November 2024 by 24.157.36.115. cAMP-dependent inhibition of the H1/peptide cotransporter cellular domain stimulates the intracellular enzymatic activity. in the human intestinal cell line Caco-2 (456). Interestingly, A mammalian hormone called guanylin is the endogenous since the H1/peptide cotransporter does not possess sites for agonist for GC-C (106). Guanylin is a 15-amino-acid peptide phosphorylation by protein kinase A (PKA), the authors pro- which contains four cysteines and is less potent than STa in pose that the effect is mediated through PKC. This hypothesis activating GC-C. Guanylin is presumed to play a role in normal would suggest another novel mechanism of CT and LT and gut homeostasis, and GC-C is apparently used opportunisti- requires substantiation in other systems. cally by STa to cause diarrhea. In addition to its enterotoxic properties, LT has the ability to Binding of STa to GC-C stimulates GC activity, leading to serve as a mucosal adjuvant. Mutants of LT which retain ad- increased intracellular cGMP levels (138, 446, 589) (Fig. 4B). juvanticity while eliminating the ADP-ribosyltransferase activ- This activity leads ultimately to stimulation of chloride secre- ity have been constructed (153, 167, 460). Mice immunized tion and/or inhibition of sodium chloride absorption, resulting orally or intranasally with ovalbumin or fragment C of tetanus in net intestinal fluid secretion. The intermediate steps in- toxin together with the mutant LTs have developed higher volved in this process are controversial, and roles for both levels of serum and local antibodies to these antigens than cGMP-dependent kinases and cAMP-dependent kinases have when the antigens are delivered without LT. This property been reported (589). Ultimately, the CFTR chloride channel is could simplify vaccine development and administration for a activated, leading to secretion of Cl2 ions into the intestinal variety of pathogens by permitting oral or nasal, rather than lumen. In contrast to the 15- to 60-min lag time needed for LT parenteral, administration of antigens. to translocate to and activate the basolateral adenylate cyclase (ii) LT-II. The LT-II serogroup of the LT family shows 55 to complex, STa acts much faster due to the apical location of its 57% identity to LT-I and CT in the A subunit but essentially no cyclase receptor. Alternative mechanisms of action for STa homology to LT-I or CT in the B subunits (229, 271, 518, 589, involving prostaglandins, calcium, and the ENS have been pro- 612). Two antigenic variants, LT-IIa and LT-IIb, which share posed (477, 478), but the evidence for the involvement of these 71 and 66% identity in the predicted A and B subunits, respec- factors is inconsistent. The secretory response to STa may also tively, have been described. LT-II increases intracellular involve phosphatidylinositol and diacylglycerol release, activa- cAMP levels by similar mechanisms to those involved with tion of PKC, elevation of intracellular calcium levels, and mi- LT-I toxicity, but LT-II uses GD1 as its receptor rather than crofilament (F-actin) rearrangement (reviewed in reference 589). 150 NATARO AND KAPER CLIN. MICROBIOL. REV. Downloaded from https://journals.asm.org/journal/cmr on 22 November 2024 by 24.157.36.115. FIG. 2. Various morphologies of diarrheagenic E. coli fimbriae as seen by transmission electron microscopy. (A) Rigid fimbrial morphology illustrated by ETEC fimbriae CS1 (labelled CFA/II in the figure). The diameter of individual fimbriae is ca. 7 nm. (B) Flexible fibrillar morphology exemplified by the CS3 component of CFA/II (arrow). Note the typical narrow diameter, ca. 2 to 3 nm, and the coiled appearance. (C) Electron micrograph showing the EPEC bundle-forming pilus expressed by strain E2348/69. Bar, 0.35 mm. Reprinted from reference 245 with permission of the publisher. VOL. 11, 1998 DIARRHEAGENIC E. COLI 151 FIG. 2— Continued. (ii) STb. STb is associated primarily with ETEC strains iso- antigens have been characterized (Table 3), although the fim- lated from pigs, although some human ETEC isolates express- briae of some ETEC strains have yet to be identified and are ing STb have been reported. STb is initially synthesized as a only presumed to exist. Clearly, the antigenic heterogeneity 71-amino-acid precursor protein, which is processed to a ma- conferred by the existence of multiple fimbrial antigens is an Downloaded from https://journals.asm.org/journal/cmr on 22 November 2024 by 24.157.36.115. ture 48-amino-acid protein with a molecular weight of 5.1 kDa obstacle to effective vaccine development. (23, 171). The STb protein sequence has no homology to that ETEC fimbriae confer the species specificity of the patho- of STa, although it does contain four cysteine residues which gen. For example, ETEC strains expressing K99 are patho- form disulfide bonds (23). Unlike STa, STb induces histologic genic for calves, lambs and pigs, whereas K88-expressing or- damage in the intestinal epithelium, consisting of loss of villus ganisms are able to cause disease only in pigs (109). Human epithelial cells and partial villus atrophy. The receptor for STb ETEC strains possess their own array of colonization fimbriae, is unknown, although it has been suggested recently that the the CFAs (150). The terminology of the CFAs is confusing and toxin may bind nonspecifically to the plasma membrane prior inconsistent. However, a uniform scheme has been proposed to endocytosis (115). Unlike the chloride ion secretion elicited which would number each putative CFA consecutively accord- by STa, STb stimulates the secretion of bicarbonate from in- ing to the year of its initial description (230); the number would testinal cells (589). STb does not stimulate increases in intra- be preceded by the initials CS, for coli surface antigen. We cellular cAMP or cGMP concentrations, although it does stim- support this proposed scheme, and it has been included in ulate increases in intracellular calcium levels from extracellular Table 3. sources (170). STb also stimulates the release of PGE2 and The CFAs can be subdivided based on their morphologic serotonin, suggesting that the ENS may also be involved in the characteristics. Three major morphologic varieties exist: rigid secretory response to this toxin (228, 294). rods, bundle-forming flexible rods, and thin flexible wiry struc- Colonization factors. The mechanisms by which ETEC tures. CFA/I, the prototype rigid rod-shaped fimbria, is com- strains adhere to and colonize the intestinal mucosa have been posed of a single protein assembled in a tight helical configu- the subject of intensive investigation (for recent reviews, see ration (308). CFA/III is a bundle-forming pilus with homology references 109, 149, 230, and 697). To cause diarrhea, ETEC to the type 4 fimbrial family (633, 634). CFA/II and CFA/IV strains must first adhere to small bowel enterocytes, an event are in fact composed of multiple distinct fimbrial structures: mediated by surface fimbriae (also called pili). Transmission CFA/II producers express the flexible CS3 structure either electron microscopy of ETEC strains typically reveals many alone or in association with the rod-shaped CS1 or CS2 (389, fimbriae peritrichously arranged around the bacterium; often, 597); CFA/IV producers express CS6 in conjunction with CS4 multiple fimbrial morphologies can be visualized on the same or CS5 (109, 363). A large number of other, less common bacterium (389) (Fig. 2B). A large number of ETEC fimbrial adhesins have also been found in ETEC strains (150), yet 152 NATARO AND KAPER CLIN. MICROBIOL. REV. FIG. 3. Pathogenic schemes of diarrheagenic E. coli. The six recognized categories of diarrheagenic E. coli each have unique features in their interaction with eukaryotic cells. Here, the interaction of each category with a typical target cell is schematically represented. It should be noted that these descriptions are largely the result of in vitro studies and may not completely reflect the phenomena occurring in infected humans. See the text for details. Downloaded from https://journals.asm.org/journal/cmr on 22 November 2024 by 24.157.36.115. epidemiologic studies suggest that CFA/I, CFA/II, or CFA/IV Epidemiology is expressed by approximately 75% of human ETEC strains ETEC strains are associated with two major clinical syn- worldwide (697). A newly described ETEC fimbria, designated dromes: weanling diarrhea among children in the developing Longus, has been found on a large proportion of human ETEC world, and traveler’s diarrhea. The epidemiologic pattern of (244, 246). ETEC disease is determined in large part by a number of The genetics of CFAs have been studied extensively, and factors: (i) mucosal immunity to ETEC infection develops in these studies have served to illuminate models for fimbrial exposed individuals; (ii) even immune asymptomatic individu- expression, protein secretion and translocation, and the assem- als may shed large numbers of virulent ETEC organisms in the bly of bacterial organelles (Fig. 5). CFA genes are usually stool; and (iii) the infection requires a relatively high infectious encoded on plasmids, which typically also encode the entero- dose (175). These three features create a situation in which toxins ST and/or LT (150). Typical fimbrial gene clusters con- ETEC contamination of the environment in areas of endemic sist of a series of genes encoding a primary fimbrial subunit infection is extremely prevalent, and most infants in such areas protein and accessory proteins which are required for process- will encounter ETEC upon weaning. The percentage of cases ing, secretion, and assembly of the fimbrial structure itself of sporadic endemic infant diarrhea which are due to ETEC (150, 308, 319, 370). The pilin structural subunit is usually the usually varies from 10 to 30% (12, 209, 298, 385, 406, 581, 654). predominant immunogen and is thus subject to the greatest School-age children and adults typically have a very low inci- antigenic pressure. Pilin subunits accordingly exhibit the great- dence of symptomatic ETEC infection. Characteristically, ST- est sequence variation; however, the N termini of the subunit producing ETEC strains cause the majority of endemic cases proteins, as well as the accessory proteins, are generally at least (12, 385). partially conserved. This phenomenon is believed to reflect Epidemiologic investigations have implicated contaminated structure-function requirements (370). Although the actual food and water as the most common vehicles for ETEC infec- protein adhesin of some E. coli fimbriae (such as pap and type tion (71, 73, 395, 700). Sampling of both food and water 1 fimbriae) is a tip protein distinct from the structural protein sources from areas of endemic infection have demonstrated comprising the stalk, the adhesin of diarrheagenic E. coli fim- strikingly high rates of ETEC contamination (550, 700); this is briae is generally the stalk protein itself. not unexpected given that 108 CFU of ETEC with buffer must VOL. 11, 1998 DIARRHEAGENIC E. COLI 153 FIG. 4. Classic mechanisms of action of ETEC toxins (see the text for details and additional proposed mechanisms). (A) LT-I. The LT holotoxin, consisting of one A subunit and five B subunits, is internalized by epithelial cells of the small bowel mucosa via endocytosis. The A1, or catalytic, subunit translocates through the vacuolar membrane and passes through the Golgi apparatus by retrograde transport. In the figure, the A subunit is shown passing through the B subunit ring, but this may not be the case in vivo. A1 catalyzes the ADP-ribosylation of arginine 201 of the a subunit of Gs-protein (which may be apically located); the ADP-ribosylated G-protein activates adenylate cyclase, which elicits supranormal levels of intracellular cAMP. cAMP is an intracellular messenger which regulates several intestinal epithelial cell membrane transporters and other host cell enzymes, as well as having effects on the cytoskeleton. The activation of the cAMP-dependent A kinase results in phosphorylation of apical membrane transporters (especially the cystic fibrosis transmembrane conductance regulator), resulting in secretion of anions (predominantly Cl2 by a direct effect, and HCO32 indirectly) by crypt cells and a decrease in absorption of Na1 and Cl2 by absorptive cells. cAMP may also have important effects Downloaded from https://journals.asm.org/journal/cmr on 22 November 2024 by 24.157.36.115. on basolateral transporters and on intracellular calcium levels, both of which may increase the magnitude of the effects on fluid and ion transport. (B) STa. Less is known about the action of ST than of LT. ST is thought to act by binding the ST membrane receptor, GC-C. Activation of GC-C results in increased levels of intracellular cGMP. cGMP exerts its effects in increasing chloride secretion and decreasing NaCl absorption by activating the cGMP-dependent kinase (G-kinase) and/or the cAMP dependent kinase (A-kinase). Other effects of STa in inducing fluid secretion have also been postulated (see the text). be given to induce high attack rates in volunteers (175, 383). ETEC traveler’s diarrhea occurs most commonly in warm and Thus, fecal contamination of water and food sources is the wet months and among first-time travelers to the developing principal reason for the high incidence of ETEC infection world (21). Traveler’s diarrhea is usually contracted from con- throughout the developing world, and the institution of appro- taminated food and water (70, 422, 700). priate sanitation is the cornerstone of preventive efforts against this infection. Clinical Considerations ETEC infections in areas of endemic infection tend to be clustered in warm, wet months, when multiplication of ETEC The clinical characteristics of ETEC disease are consistent in food and water is most efficient (381). Person-to-person with the pathogenetic mechanisms described above. Similar transmission was not found to occur during a study of ETEC- features of the illness have been demonstrated in both volun- infected volunteers housed side by side with volunteers en- teers and patients in areas of endemic infection. The illness is rolled in an evaluation of influenza vaccine candidates (388). typically abrupt in onset with a short incubation period (14 to Although ETEC infection occurs most frequently in infants, 50 h) (175, 459). The diarrhea is watery, usually without blood, immunologically naive adults are susceptible (this stands in mucus, or pus; fever and vomiting are present in a minority of contrast to EPEC infection, as described below). Indeed, patients (175, 381). ETEC diarrhea may be mild, brief, and ETEC is the predominant etiologic agent causing traveler’s self-limiting or may result in severe purging similar to that seen diarrhea among adults from the developed world visiting areas in V. cholerae infection (383). where ETEC infection is endemic (21, 70, 174, 422). Studies Most life-threatening cases of ETEC diarrhea occur in suggest that 20 to 60% of such travelers experience diarrhea; weanling infants in the developing world. Even though the typically, 20 to 40% of cases are due to ETEC. Predictably, administration of antibiotics to which ETEC strains are sus- 154 NATARO AND KAPER CLIN. MICROBIOL. REV. TABLE 3. CFAs of human ETEC strains purified fimbriae, attenuated ETEC strains, and attenuated Salmonella, Shigella, and V. cholerae strains expressing ETEC Original designation CS designation Diameter (nm) Reference(s) antigens (reviewed in references 626 and 630). An oral cholera vaccine containing killed V. cholerae and purified CT B subunit Rigid rods has been reported to provide protection against traveler’s di- CFA/I CFA/I 7 321 arrhea due to ETEC (511). This protection is presumably due CS1 CS1 7 225, 320, 513 to the antigenic similarity between LT and CT, although this CS2 CS2 7 226 CS4 CS4 6 698 would not explain the protection against ETEC strains express- PCFO159 CS12 7 576 ing ST. Development of an ETEC vaccine with broad protec- PCFO166 CS14 7 427 tion is greatly complicated by the numerous intestinal coloni- CS17 CS17 7 428 zation factors expressed by ETEC. PCFO20 CS18 7 680 CS19 CS19 7 230 Detection and Diagnosis CS20 CS20 7 671 Detection of ETEC has long relied on detection of the Bundle-forming enterotoxins LT and/or ST. ST was initially detected in a rabbit CFA/III CS8 7 634 Longus CS21 7 244 ligated ileal loop assay (193), but the expense and lack of standardization caused this test to be replaced by the suckling- Fibrillar mouse assay (236), which became the standard test for the CS3 CS3 2–3 86 presence of STa for many years. The suckling-mouse assay CS5 CS5 5 127, 411 entails the measurement of intestinal fluid in CD4 infant mice PCFO148 CS11 3 362 after percutaneous injection of culture supernatants. PCFO9 CS13 285 Several immunoassays have been developed for detection of ST, including a radioimmunoassay (237) and an enzyme-linked Nonfimbrial immunosorbent assay (ELISA) (144) (available from Denka CS6 CS6 698 2230 CS10 147 Seiken, Co. Ltd., Tokyo, Japan). Both of these tests correlate 8786 CS15 25 well with results of the suckling-mouse assay and require sub- stantially less expertise (144). The traditional bioassay for detection of LT involves the use of cell culture, either the Y1 adrenal cell assay or the Chinese ceptible has been shown to decrease both the duration of hamster ovary (CHO) cell assay. In the Y1 assay, ETEC cul- diarrhea and the intensity of ETEC excretion (72, 173), effec- tive agents may not be available in areas where the incidence is high; moreover, antibiotic resistance in ETEC strains is an emerging problem, and in many areas (174) effective agents which are safe for children are not readily available. It should be kept in mind, therefore, that the cornerstone of manage- ment of ETEC infection is to maintain a normal hydration status. Oral rehydration therapy is often lifesaving in infants and children with ETEC diarrhea. Downloaded from https://journals.asm.org/journal/cmr on 22 November 2024 by 24.157.36.115. Travelers to the developing world should also be counseled on the need to maintain hydration when they experience diar- rhea. In addition, bismuth subsalicylate or loperamide is effec- tive in decreasing the severity of diarrhea (21); the latter should not be administered to patients with fever or dysentery unless antibiotics are also given. Antibiotics given empirically for traveler’s diarrhea can shorten the duration of the episode (191). Currently, fluoroquinolones (e.g., ciprofloxacin, nor- floxacin, and ofloxacin) are the most commonly recommended agents, since increasing antimicrobial resistance to traditional agents has been documented in several areas (173, 174). FIG. 5. Genetics of E. coli fimbriae. Genes required for the expression of Travelers to developing areas are often concerned with the functional pili are characteristically linked in gene clusters. The genetic organi- development of traveler’s diarrhea and may seek a means of zation of these clusters is illustrated for ETEC fimbriae CS1, CFA/I, CS3, and preventing it. Doxycycline and trimethoprim-sulfamethoxazole CS6, and for members of the Dr family, found in DAEC and EAEC. Italicized have been shown to be effective in this regard, although in- terms in parentheses represent the gene designations, to be followed by the specific letter under the corresponding arrow to the right. Arrows of similar fill creasing resistance would suggest that fluoroquinolones ad- pattern have genetic and functional homology; black arrows represent structural ministered once daily would be more effective (280). However, subunits. The known functions of the genes in the Dr cluster are listed below the the growing problem of antibiotic resistance and the possibility corresponding genes. These functions can be extrapolated to arrows of similar fill of adverse effects from antimicrobial agents weigh strongly pattern in the CS3 and CS6 gene cluster. The usher and chaperone genes from the Dr, CS6, and CS3 clusters have homology to the genes serving these functions against recommending antimicrobial prophylaxis routinely. in pap fimbriae: usher proteins are OMPs which serve as pores for the transport Rather, experts have recommended (i) avoiding potentially and assembly of the fimbrial shaft; fimbrial chaperones bind to the fimbrial contaminated food and drink while traveling, (ii) bismuth sub- subunit proteins in the periplasmic space and prevent premature folding and salicylate given four times daily, and (iii) the use of antibiotics degradation. CS1 and CFA/I accessory genes, required for assembly and trans- port of the fimbriae, are homologous to each other but not to CS3, CS6, or the empirically if significant diarrhea develops (174). Dr family. CS6 has an unusual organization in that the first two genes of the Oral vaccines against ETEC are being developed by a variety cluster apparently encode heterologous major subunit proteins (699); the signif- of approaches including the use of killed whole cells, toxoids, icance of this feature is not yet understood. VOL. 11, 1998 DIARRHEAGENIC E. COLI 155 ture supernatants are added to Y1 cells and the cells are Pathogenesis examined for rounding (165). In the CHO cell assay, LT will cause elongation of the CHO cells (265). Immunologic assays Attaching-and-effacing histopathology. The hallmark of in- are easier to implement in clinical laboratories and include the fections due to EPEC is the attaching-and-effacing (A/E) his- traditional Biken test (297) as well as newer immunologic topathology, which can be observed in intestinal biopsy speci- methods such as ELISA (709), latex agglutination (304), and mens from patients or infected animals and can be reproduced two commercially available tests, the reversed passive latex in cell culture (18, 314, 358, 453, 524, 547, 616, 640, 667, 669) agglutination test (582) and the staphylococcal coagglutination (Fig. 6). This striking phenotype is characterized by effacement test (116). Both of the commercially available tests are reliable of microvilli and intimate adherence between the bacte- and easy to perform (613). rium and the epithelial cell membrane. Marked cytoskeletal ETEC strains were among the first pathogenic microorgan- changes, including accumulation of polymerized actin, are seen isms for which molecular diagnostic techniques were devel- directly beneath the adherent bacteria; the bacteria sometimes oped. As early as 1982 (455), DNA probes were found to be sit upon a pedestal-like structure. These pedestal structures useful in the detection of LT- and ST-encoding genes in stool can extend up to 10 mm out from the epithelial cell in pseu- and environmental samples. Since that time, several advances dopod-like structures (453). This lesion is quite different from in ETEC detection have been made, but genetic techniques the histopathology seen with ETEC strains and V. cholerae, in continue to attract the most attention and use. It should be which the organisms adhere in a nonintimate fashion without stressed that there is no perfect test for ETEC: detection of causing microvillous effacement or actin polymerization. Al- colonization factors is impractical because of their great num- though earlier studies had also reported this histopathology, it ber and heterogeneity; detection of LT and ST defines an was not until the report by Moon et al. (453) that the pheno- ETEC isolate, yet many such isolates will express colonization type became widely associated with EPEC and the term “at- factors specific for animals and thus lack human pathogenicity. taching and effacing” was coined. The LT polynucleotide probe provides good sensitivity and The initial observation by Knutton et al. (359) that the com- specificity when labeled with radioisotopes (373, 455) or with position of the A/E lesion contained high concentrations of enzymatic, nonisotopic detection systems (528). Several differ- polymerized filamentous actin (F-actin) led to the develop- ent protocols have been published in which nonisotopic label- ment of the fluorescent-actin staining (FAS) test. In this test, ing methods have proven useful for LT detection (2, 117, 718); fluorescein isothiocyanate (FITC)-labeled phalloidin binds specifically to filamentous actin in cultured epithelial cells di- we now use a highly reliable alkaline phosphatase-based de- rectly beneath the adherent bacteria. Prior to the development tection system (Blue Gene; Gibco-BRL) for use in polynucle- of this test, the A/E histopathology could be detected only by otide probe colony blot hybridization. the use of electron microscopy and intact animals or freshly ST polynucleotide probes have had problems of poor sensi- isolated intestinal epithelial cells. Besides providing a diagnos- tivity and specificity, presumably because of the small size of tic test for EPEC strains and other organisms capable of caus- the gene. For this reason, oligonucleotide probes which are ing this histopathology, the FAS test enabled the screening of generally more sensitive and specific for ST detection have clones and mutants, leading to the identification of the bacte- been developed (581) (Table 2 lists the nucleotide sequences rial genes involved in producing this pathognomonic lesion. of oligonucleotides used for probing and PCR of diarrheagenic In addition to F-actin, the composition of the A/E lesion E. coli strains). An LT oligonucleotide has also been developed includes other cytoskeletal components such as a-actinin, talin, (581), but this reagent has relatively few advantages over an ezrin, and myosin light chain (205). At the tip of the pedestals enzymatically detected LT fragment probe. Recently, a triva- beneath the plasma membrane are located proteins that are Downloaded from https://journals.asm.org/journal/cmr on 22 November 2024 by 24.157.36.115. lent oligonucleotide probe has been proposed which may be of phosphorylated on a tyrosine residue in response to EPEC use in detecting the genes encoding LT, ST, and the EHEC infection (see below). The formation of the pedestal is a dy- Shiga toxin genes (see below); this probe shows promise in an namic process, and video microscopy shows that these EPEC early report (44). ETEC strains are particularly amenable to pedestals can bend and undulate, alternatively growing longer stool blot hybridization because of the large number of organ- and shorter while remaining tethered in place on the cell sur- isms typically shed in the stools of infected individuals (615). face (557). Some of the attached EPEC organisms can actually Several PCR assays for ETEC are quite sensitive and spe- move along the surface of the cultured epithelial cell, reaching cific (177, 374, 492, 581, 615, 654) when used directly on clinical speeds up to 0.07 mm/s in a process driven by polymerization of samples or on isolated bacterial colonies. A useful adaptation actin at the base of the pedestal. This motility resembles that of PCR is the “multiplex” PCR assay (374, 615), in which seen with Listeria spp. (650) inside eukaryotic cells, except that several PCR primers are combined with the aim of detecting the motile EPEC organisms are located extracellularly. The one of several different diarrheagenic E. coli pathotypes in a significance of this motility observed in vitro to the pathogen- single reaction. After multiplex PCR, various reaction prod- esis of disease caused by EPEC is unknown. Similar A/E le- ucts can usually be differentiated by product size, but a sec- sions are seen in animal and cell culture models of EHEC (see ond detection step (e.g., nonisotopic probe hybridization) below) and Hafnia alvei isolated from children with diarrhea is generally performed to identify the respective PCR (9, 11). Howe