Ancient DNA PDF

Ancient DNA Several archaic hominin species overlapped in time with our own Modern genomic methods have allowed us to learn about the genomes of extinct species Homo sapiens that left Africa interbred with Neanderthals and Denisovans https://www.smithsonianmag.com/science-nature/...

Ancient DNA Several archaic hominin species overlapped in time with our own Modern genomic methods have allowed us to learn about the genomes of extinct species Homo sapiens that left Africa interbred with Neanderthals and Denisovans https://www.smithsonianmag.com/science-nature/ancient-teeth-neanderthal- features-reveal-chapters-human-evolution-180970460/ Copyright 2023, Morton SUNY Brockport Ancient DNA Objectives Apply concepts (including sequencing, population genetics, and organellar DNA) in learning about the field of archaic genome research https://www.smithsonianmag.com/science-nature/ancient-teeth-neanderthal- features-reveal-chapters-human-evolution-180970460/ Copyright 2023, Morton SUNY Brockport  Monday Tuesday Wednesday Thursday Friday Week of Dec 11 FINAL!!!!! 8am-10am REVIEW (12:30-2pm) REVIEW Lennon 206 (2pm-3:30) Lennon 206 Copyright 2023, Morton SUNY Brockport The field of ancient DNA is very young Svante Pääbo, a Swedish geneticist, won the 2022 Nobel Prize in Physiology or Medicine He was the first to successfully extract and sequence ancient DNA from a Neanderthal He and his team completed a draft reference sequence of the Neanderthal genome in 2009 https://www.nih.gov/news-events/nih-research-matters/neanderthal-genome-sequenced Copyright 2023, Morton SUNY Brockport The study of ancient DNA intersects many of the topics we have covered -Reference sequences -Cloning -Population genetics -mtDNA Copyright 2023, Morton SUNY Brockport Hominin species There are at least three hominin species that we are sure co- inhabited the Earth with us (Homo sapiens) at some point Neanderthals ~400,000 to ~30,000 years ago Denisovans ~400,000 to ~30,000 years ago Homo floresiensis ~100,000 to ~50,000 years ago https://humanorigins.si.edu/evidence/human-fossils/species/homo-floresiensis Copyright 2023, Morton SUNY Brockport Challenges of ancient DNA Very little DNA can be recovered from a sample (and you have to destroy part of the sample to get it) Samples (ancient fossils) aren’t that easy to come by in the first place Any DNA extracted will be mostly contamination (from DNA in soil microbes, humans Smithsonian Museum of Natural handling the samples, etc.) History’s clean room for ancient DNA The ancient DNA will be in damaged fragments Recovery of ancient DNA is done in a clean room. (degraded with time). Only 100-200bp long https://www.smithsonianmag.com/blogs/national-museum-of-natural-history/2018/04/26/safety-suit-new-clean-room-allows-scientists-study-fragile-ancient-dna/ Copyright 2023, Morton SUNY Brockport Much of the early research into ancient DNA focused on sequencing mitochondrial DNA (mtDNA). What about mtDNA might help explain why early research focused on it? Copyright 2023, Morton SUNY Brockport Challenges of ancient DNA We don’t know the DNA sequence of Neanderthals beforehand Option 1: do PCR using primers designed for human DNA and hope they match the sequence Option 2: clone fragments Sample removed from right humerus of of the DNA directly from Neanderthal specimen from western Germany the sample and then sequence them Krings et al. 1997 Copyright 2023, Morton SUNY Brockport Sequencing Neanderthal DNA A complete sequence of a Neanderthal mitochondrial genome was published in 2008 16,565 base pairs (Green et al. Cell, 2008) Remember that human mtDNA is 16,569bp What about the rest (bulk) of the genome? DNA was extracted from a 38,000-year-old Neanderthal specimen from Vindija, Croatia Noonan et al. Science 2008 Copyright 2023, Morton SUNY Brockport  What is does the ring structure in this diagram represent? Noonan et al. Science 2008 A Neanderthal chromosome A bacterial chromosome The Neanderthal mitochondrial genome A plasmid An Eppendorf tube Copyright 2023, Morton SUNY Brockport  Grow up a collection of the plasmid- containing bacteria Noonan et al. Science 2008 Sequence 65,250bp of Neanderthal BLAST against human genome sequence reference genome recovered Copyright 2023, Morton SUNY Brockport Sequencing Neanderthal genome Additional sequencing was done using three samples found in Vindija (Green et al. Science, 2010) Cave in Vindija, Croatia Note that in these DNA extract, 95-99% of the sequence in their libraries was from non-primate organisms (mostly microbes) In 2010, a draft of the whole Neanderthal genome was published (Green et al. Science, 2010) Neanderthal DNA was found to be 99.7% identical to modern human https://en.wikipedia.org/wiki/Vindija_Cave Copyright 2023, Morton SUNY Brockport  The mtDNA from each of the three samples was compared Two of the samples had identical mtDNA Does this mean that two of the samples must have come from the same individual? A. Yes, they have to be from the same individual B. No, it is possible they are from different individuals Copyright 2023, Morton SUNY Brockport Who were Neanderthals? Neanderthal/Neandertal The first fossil was found in the Neander Valley in Germany (Neander Thal) in 1856 Fossils in Europe date to about 400,000 years ago Disappeared ~30,000-40,000 years ago Low, flat, elongated skull Barrel-shaped, rib cages, Short bowed shoulder blades Adaptations to cold environment Used tools Suffered frequent injuries Abstract rock engraving made by Neanderthals, Gibraltar J. Rodríguez-Vidal et al. 2014 https://www.sciencedirect.com/science/article/pii/S0960982222013045 Copyright 2023, Morton SUNY Brockport Who were Neanderthals? Neanderthal/Neandertal Range included Europe, southwestern and central Asia Co-existed with modern humans in these areas for about 30,000-40,000 years. Unclear how much interaction there was. Leo Pallanck, UW Copyright 2023, Morton SUNY Brockport  There is evidence that Neanderthal populations experienced an extended period of bottlenecking. Bottlenecking is when the population is drastically reduced in size – only a small subset of individuals remain of a once-larger population What would you predict about the genetic consequences of bottlenecking? Harris and Nielson, 2016 Copyright 2023, Morton SUNY Brockport Genetic bottlenecks In genetic bottlenecks, a relatively large population is reduced to a small number by a catastrophic event unrelated to natural selection Survivors of the bottleneck likely have a low level of genetic diversity and usually carry alleles in very different frequency than the original population For a small population size, there is now a chance that a deleterious allele will be in high proportion It is under debate if lack of genetic diversity contributed to Neanderthal extinction. Other possible contributing factors: competition with humans, climate change… Copyright 2023, Morton SUNY Brockport One of the big questions… If Homo sapiens and Neanderthals overlapped…did they interbreed? Copyright 2023, Morton SUNY Brockport Did Homo sapiens encounter and interbreed with Neanderthals (and other archaic hominins) after leaving Africa? Neanderthals left Africa ~400,000 years ago and migrated to Europe and Asia Homo Sapiens appeared ≈200,000 years ago; some left Africa ≈70,000 years ago Neanderthals went extinct ≈30,000-40,000 years ago Neanderthals and Homo sapiens overlapped geographically (outside of Africa) for ~30,000-40,000 years Leo Pallanck, UW Copyright 2023, Morton SUNY Brockport Did Homo sapiens encounter and interbreed with Neanderthals (and other archaic hominins) after leaving Africa? Neanderthals left Africa ~400,000 years ago and migrated to Europe and Asia Homo Sapiens appeared ≈200,000 years ago; some left Africa ≈70,000 years ago Neanderthals went extinct ≈30,000-40,000 years ago Neanderthals and Homo sapiens Did Neanderthals interbreed with Homo overlapped geographically (outside sapiens in Europe and Asia before going of Africa) for ~30,000-40,000 years extinct? Leo Pallanck, UW Copyright 2023, Morton SUNY Brockport Did Homo sapiens encounter and interbreed with Neanderthals (and other archaic hominins) after leaving Africa? If interbreeding did occur, there should be traces of Neanderthal DNA in the descendants of the population that interbred with Neanderthals (AKA: introgression or admixture) Introgression: a chunk of DNA from one species or line transferred into another (as the result of a mating event) Admixture: when DNA indicates that individuals of distantly related populations or species interbred Copyright 2023, Morton SUNY Brockport How did scientists try to answer the question of if Homo sapiens and Neanderthals interbred? The Neanderthal sequences were aligned to the Homo sapiens genome sequence Homo sapiens DNA sequence Neanderthal DNA sequences Copyright 2023, Morton SUNY Brockport The genomes of non-Africans were found to harbor Neanderthal DNA sequences! Some Neanderthal DNA was found on all of the autosomes Red lines represent regions where some people have Neanderthal sequence variants There are some regions where no one has Neanderthal DNA There was very little Neanderthal DNA found on the X chromosome Copyright 2023, Morton SUNY Brockport Worldwide distribution of Neanderthal DNA Europeans East Asians 2% Neanderthal 3% Neanderthal West Africans South Asians 0% Neanderthal 2% Neanderthal East Africans 0.5% Neanderthal Australians 2% Neanderthal Evidence of introgression How could one population have 3% Neanderthal DNA and another population 0%, if all humans are 99.9% identical? Neanderthal and human DNA is already 99.7% identical Pop 1: ACGATACAGTACGATTCGAAGTAAGCGGCGTACGT Pop 2: ACGATACAGTACCATTCGTAGTAATCGGCGTACGT Neand: ACGGTACTGTACCATTCGTAGTAATCGGAGTACTT Haploblocks (≈50,000bp on average) where the variation in the sequences matches better in Neanderthals and non-Africans than in Africans -> evidence of introgression Copyright 2023, Morton SUNY Brockport Summary on Neanderthals Populations of modern humans and Neanderthals cohabited in Eurasia for millennia As much as ~4% of some modern human genomes are of Neanderthal origin Introgression of Neanderthal DNA into the genome is found in all non-Africans assayed and some North and East Africans, but not sub-Saharan Africans This pattern of introgression indicates that interbreeding between Neanderthals and modern humans took place after the migration of modern humans out of Africa Copyright 2023, Morton SUNY Brockport Who were Denisovans? In 2008, a finger bone and three teeth were found in Denisova Cave in the Altai Mountains in southern Siberia. The mtDNA of the finger bone was sequenced and reported in 2010 to be a new hominin species: Denisovans! https://www.nature.com/articles/s41576-023-00643-4 https://www.science.org/doi/pdf/10.1126/science.adr8007 https://www.livescience.com/22833-denisovan-fossils-gallery.html Copyright 2023, Morton SUNY Brockport Who were Denisovans? Based on nuclear DNA comparisons, Denisovans are more closely related to Neanderthals than either was to humans. They shared a common ancestor about 400,000 years ago DNA from four Denisovans from a single location show genetic diversity comparable with that seen in Neanderthals from all across Eurasia from many time periods Studies indicate that interbreeding occurred between Denisovans and modern humans migrating eastward out of Africa toward Australia Copyright 2023, Morton SUNY Brockport Worldwide distribution of Denisovan DNA Europeans East Asians 0% Denisovan 0.1% Denisovan West Africans South Asians 0% Denisovan 0.1% Denisovan East Africans Melanesians 0% Denisovan 5% Denisovan Australians 4% Denisovan Reich et al. Nature 2010 Copyright 2023, Morton SUNY Brockport Hominin species There are at least three hominin species that we are sure co- inhabited the Earth with us (Homo sapiens) at some point Neanderthals ~400,000 to ~30,000 years ago Denisovans ~400,000 to ~30,000 years ago Homo floresiensis ~100,000 to ~50,000 years ago https://humanorigins.si.edu/evidence/human-fossils/species/homo-floresiensis Copyright 2023, Morton SUNY Brockport Homo floresiensis Estimated to be ~3.5 ft tall Fossils found on the island of Flores, Indonesia, in 2003 Small size may represent adaptation to the reduced resources on an island – there were also small stegodonts (elephant relative) on Flores Used stone tools DNA degrades faster in warmer climates, so much less is known about their genome https://en.wikipedia.org/wiki/Homo_floresiensis Copyright 2023, Morton SUNY Brockport DNA degrades over time Current estimates are that 1 million years is about the maximum length of time we could possibly recover any DNA FYI, dinosaurs went extinct 65 million years ago. (Even if it were in amber, DNA would still have degraded) https://www.sciencefriday.com/articles/the-paleobiologist-who-inspired-the-science-in-jurassic-park/ Copyright 2023, Morton SUNY Brockport Reminders about this week One more office hour! Today, right now. No late assignments or corrections will be accepted after today Review session Monday Dec 9 in Lennon 206 Review session Tuesday Dec 10 in Lennon 206 FINAL Wednesday Dec 11, 8:00 AM!! GOOD LUCK ON YOUR FINALS!!! Copyright 2023, Morton SUNY Brockport