Mutation PDF

17.8 Mutation a)Describe the different types of gene mutation with examples of its consequence : i) Substitution  Definition  Example : sickle-cell anemia ii) Insertion/Addition  Definition  Frameshift mutation iii) Deletion  Definition...

17.8 Mutation a)Describe the different types of gene mutation with examples of its consequence : i) Substitution  Definition  Example : sickle-cell anemia ii) Insertion/Addition  Definition  Frameshift mutation iii) Deletion  Definition  Frameshift mutation  Example : thalassaemia major iv) Inversion  definition Definition: is a change in the amount , arrangement or structure of DNA in an organism which can produce a change in the phenotype and physiological processes of the organism.  An organism affected by a mutation is described as mutant 17.8.1 Classification 1. Somatic mutations  Occurs in somatic cell such as skin cells, stem cells of the bone and fibroblast cells in various organs such as liver and lung  Cannot be inherited (transmitted to the next generation)  Can be transmitted only to the daughter cells through mitosis  Example: cancer of the liver, non-malignant tumour 2. Germ-cell mutation (sex cell mutation)  Occurs in reproductive cells during formation of gametes  Can be inherited to the future generation  Example : haemophilia 3. spontaneous mutation  are mutations which suddenly appear/occurs as a result of natural processes  occurs during DNA replication and from chemical changes in the DNA’s nitrogenous bases. 4. induced mutations  occurs as a result of interaction of DNA with mutagens, like radiation and chemicals. Mutagens:  are agents that cause mutation  are of two types  physical mutagens : X-ray, gamma rays, ultra - violet rays  chemical mutagens: colchicines, mustard gas, formaldehyde, benzene, certain chemicals in tobacco, certain pesticides and herbicides. 5. gene mutations (point mutation)  a change in the sequence of nucleotide bases of the DNA that corresponds to a particular gene. 6. chromosomal mutations  involve the change in chromosomal number or its structure. Effects of mutations  synthesis of a non-functional protein  lowers production of a particular protein  prevents the synthesis of a protein  adds more nucleotide bases to the gene, giving the product a new function which may be harmful to the cells. Importance:  source of genetic variation that provides the raw material for evolution. 17.8.2 Gene mutation  A change in the sequence of nucleotide bases of the DNA that corresponds to a particular gene  change in a single base or nucleotide  results in a change of sequences of amino acid in a protein  change in phenotype  four types of gene mutation: substitution, insertion,deletion and inversion. i)Substitution  one base is substituted for another base.  Example : sickle cell anaemia , a disease which causes severe lack of oxygen.  the β polypeptide chain of the Hb molecule has been altered  the normal HbA is replaced by HbS.  a change in a single nucleotide i.e adenine in the triplet code GAA is replaced by uracil ( GAA → GUA)  such that the amino acid valine has been substituted for the amino acid glutamate  the red blood cells containing HbS appear sickle-shaped  amount of oxygen carried is low leading to acute anaemia. o Substitution mutations are usually ‘missense mutations’ that is the altered codon still codes for an amino acid and thus makes sense, although not necessarily the ‘right’ sense. o If the altered codon is a stop codon, translation will be terminated prematurely resulting in a non-functional protein. This alteration is called a ‘nonsense mutation’ ii)Insertion/addition  One or more bases is inserted into the DNA sequence iii)Deletion  One or more bases is deleted from the sequence.  Example: Thalassaemia major; a gentic disease which affects the Hb molecules. o Insertion and deletion mutations may cause a shift in the reading frame of the DNA molecule whenever the number of nucleotide inserted is not a multiple of three. o Insertion and deletion mutations are also referred to as a frameshift mutation. iv) Inversion  a segment /sequence of DNA is broken at two places , rotated 1800/inverted and rejoined 17.8.3 Chromosomal mutation  Chromosomal aberration a) Change in chromosome number  Aneuploidy and euploidy/polyploidy  Definition of autosome and sex chromosome terms meaning Aneuploidy 2n ± chromosome Monosomy 2n - 1 chromosome Trisomy 2n + 1 chromosome Tetra-, penta-,........... 2n + 2, 2n + 3,............ Euploidy Multiple of n Diploidy 2n Triploidy 3n Tetra-, penta, hexa 4n, 5n polyploidy 3n, 4n, 5n, 6n Autopolyploidy Multiplication due to the same genome Allopolyploidy Multiplication due to different genome (i) Aneuploidy  Definition  Non-disjuntion during meiosis  Abnormalities of autosome number - monosomy: resulting in sterility and reatarded growth - trisomy: Down syndrome (trisomy 21)  abnormalities of sex chromosome number - Klinefelter syndrome (47, XXY) - Turner syndrome (45,X) (ii) Euploidy/polyploidy  Definition of euploidy/polyploidy, autopolyploidy, allopolyploidy  Examples in plants b) Change in chromosome structure (i) Inversion  definition (ii) Translocation  definition (iii) Deletion  definition (iv) Duplication/multiplication  definition Chromosomal mutation Definition: changes in the number or structure of chromosomes. a) Change in chromosome number  Two types of changes: aneuploidy and euploidy (i) Aneuploidy Definition:  Change in chromosome number that is not an exact multiple of the haploid set/n.   Normal diploid species have 2n chromosomes, where n is the number in the haploid set.  Aneuploid individuals would have 2n-1 chromosomes (monosomy) ,2n+1 (trisomy) or some other arrangements.  Causes of aneuploidy: non-disjunction during meiosis I and II Non-disjunction  failure of a pair of homologous chromosomes to separate during anaphase I of meiosis and move to the opposite poles. (Disjunction : chromosomes separate to the opposite poles during meiosis.)  non-disjunctions result in the production of two types of abnormal gametes, one which contains an extra chromosome (n + 1) and the other which lacks a chromosome ( n -1)  fertlisation of such a gamete with a normal gamete produces a trisomy(2n+1) or monosomy(2n-1) aneuploid zygote. Abnormalities of autosome number Examples: (i) monosomy  the loss of one chromosome which produces a 2n-1 complement  in humans , individuals with autosomal monosomy do not survive embryonic and foetal development  e.g monosomy 21  (ii) trisomy  the gain of one chromosome which produces a 2n+1 complement  in humans, an example of autosomal trisomy is a condition called Down’s syndrome or trisomy 21 (2n=47)  the karyotype is written as 47,XY,+21  the key to the karyotype description is as follows: - 47: the total number of chromosome - XY: the sex chromosomes (male) - +21: designates the extra chromosome as a 21  It is the result of non-disjunction of chromosome 21 during meiosis.  The symptoms of Down’s syndrome include: - mental retardation - reduced resistance to disease - congenital heart abnormalities - a short stocky body - thick neck - folds of skin over the inner corner of the eye Abnormalities of sex chromosome number  as a result of non-disjunction during spermatogenesis and oogenesis.  non-disjunction during spermatogenesis : sperm will have the abnormal sex chromosome XY,XX @ YY  non-disjunction during oogenesis : some ovum might not carry any chromosome X and some others might carry 2 chromosome X  examples: i. Klinefelter’s syndrome  Syndrome are trisomic occurring in men, with extra X chromosome. (47,XXY)  The symptom’s include: - small penis - sparce pubic hair - absence of body hair - some breast development - small testis lacking spermatogenesis(sterile) - long bones often longer than normal - usually low intelligence ii. Turner’s syndrome  Syndrome are monosomic occurring in female , with only one single X chromosome. (45,XO)  The symptom’s include: - short stature - webbed neck - lacking normal secondary sexual characteristics - gonads undifferentiated secreting no hormones; so no menstrual cycle - no pubic hair (ii) Euploidy/polyploidy Definition:  Change in chromosome number that is an exact multiple of the haploid set/n   For example: a diploid has 2n chromosomes a triploid has a tetraploid has a pentaploid has  Gametes and somatic cells which has three or more times the haploid number of chromosomes are called polyploids.  The prefixes, tri-, tetra etc indicate the extent of polyploidy  Polyploidy is much more common in plants than in animals.  polyploidy is often associated with advantageous features such as increased size, hardiness, and resistance to disease  most of the domestic plants are polyploids producing large fruits, storage organs, flowers or leaves.  There are two forms of polyploidy: autopolyploidy and allopolyploidy. Autoployploidy  multiplication of chromosome from the same species.  For example: if chromosomes undergo replication ( during interphase) and the chromatids separate normally (during anaphase) but the cytoplasm fails to cleave (during cytokinesis), a tetraploid (4n) cell with a large nucleus is produced.  This cell will undergo division and produce tetraploid cells.  Autopolyploidy can be induced by the use of a drug called colchicine.  Colchicine inhibit spindle formation by disrupting microtubules so that chromatids fail to separate during anaphase.  Autopolyploid plants are larger and grow vigorously than their diploid relatives and are of greater commercial value.  Examples of triploids : seedless watermelon, commercial bananas tetraploids: coffee, peanuts, Mcintosh apple Allopolyploidy  multiplication of chromosome from different species.  This condition arises when the chromosome number in a sterile hybrid becomes doubled and produces fertile hybrids.  Example: bread wheat Triticum aestivum a hexaploid (6n) 17.3.2 Change in chromosome structure  There are four types of chromosomal structural mutations: inversion, translocation, deletion and duplication. Inversion:  a segment of a chromosome is broken at two places , rotated 1800/inverted and rejoined.  No change in genotype occurs but phenotypic changes may be seen Translocation  A segment of a chromosome is broken and reattached to a non-homologous chromosome  The total genetic information is not changed  The individual is often totally normal  However their offspring may have missing or too much genetic information which may cause abnormalities   This is because if the translocation mutation was present in the gamete forming cells, gametes will receive either a chromosome with additional genetic information or a chromosome with missing genetic information. Deletion  A segment of a chromosome is broken and does not rejoined/is lost  In deletion, one or more genes may be lost and this almost always results in genetic disorder  Example: cri-du-chat syndrome, which results from a deletion on the short arm of chromosome 5.  A patient with this order is mentally retarded. Duplication  A segment of a chromosome is multiplied/repeated. Objective Questions 1. Gambar rajah di bawah menunjukkan struktur kromosom yang mengalami mutasi. Apakah jenis mutasi yang digambarkan diatas? A. Euplodi B penyisipan C translokasi D penggantian 2. Jadual dibawah menunjukkan bilangan kromosom dalam spesies induk kubis Brassica oleracea dan lobak Raphanus sativus serta hybrid-hibrid yang dihasilkan. Jenis sel Bilangan kromosom per sel Kubis induk 18 Lobak induk 18 Gamet induk 9 Hibrid F1 18 Gamet F1 18 Hibrid F2 36 Gamet F2 18 Hibrid F3 36 Mutasi kromosom berlaku semasa A. penyatuan gamet induk B pembentukan gamet F1 C penyatuan gamet F1 D pembentukan gamet F2 3. Gambar rajah di bawah menunjukkan dua jenis mutasi kromosom yang menyebabkan perubahan urutan gen. Apakah proses yang menyebabkan berlakunya mutasi kromosom I dan II diatas? I II A penyongsangan pelenyapan B penyongsangan penduaan C pelenyapan penyongsangan D translokasi pelenyapan 4. Klinefelter syndrome is an example of A euploidy B aneuploidy C allopolyploidy D autopolyploidy 5. The table below shows types of mutations and their examples. Type of mutation Example I base substitution (a) sickle cell anaemia II aneuploidy (b) cri-du-chat III chromosome deletion (c) Down’s syndrome IV base deletion (d) Thalassaemia Which of the following is correct about the types of mutations and their examples? I II III IV A (a) (c) (b) (d) B (d) (a) (c) (b) C (b) (c) (a) (d) D (c) (d) (a) (b) 6. Which of the following is the result of the non-disjunct ion process during meiosis? A Thalassaemia B Haemophilia C Down’s syndrome D Sickle cell anaemia 7. Which of the following is the genotype of Klinefelter syndrome? A XO B XXY C XYY D XXX 8. Which of the following mutations in human is/are trisomic? I Down syndrome II Turner syndrome III Thalassaemia major A I only B II only C I and II D II and III 9. Which of the following is not true of mutation? A A chromosomal mutation of the deletion type involves the deletion of a base pair from a gene B Genetic disease called cri-du-chat syndrome is caused by a deletion in chromosome 5. C the deletion of two bases causes frame-shift mutation during triplet coding in transcription D Allopolyploidy is a chromosomal mutation which involves chromosome doubling caused by different genomes. 10. The table below shows two plant species and their respective chromosome sets. species Chromosome set 1 PP 2 SS Which of the following individuals is an allotetraploid plant? A PPPP B PPSS C PSSS D SSSS 11. Which of the following causes frameshift mutation? A addition of a nucleotide B inversion of six nucleotides C substitution of three nucleotides D addition of a nucleotide before the start codon 12. The following is a sequence of DNA and two mutated sequences I and II. CGTACGGCAATGCCTATATGGCGC ↓mutation I CGTCCGGCAATGCCTATATGGCGC II CGTACGGCAATGCTCATATGGCGC Which of the following are true of mutations I and II? I II A Inversion Inversion B Inversion Substitution C Substitution Inversion D Substitution Substitution 13. The table below shows types of genetic abnormalities and their causes. Genetic abnormality Cause I Sickle- cell anaemia P An extra of X chromosome II Thalassaemia major Q 44 autosomes + 1 X chromosome III Down syndrome R Base substitution of haemoglobin gene IV Klinefelter syndrome S Trisomy 21 V Turner syndrome T Base deletion of the haemoglobin gene Which are the causes of the types of genetic abnormality? I II III IV V A P R Q S T B P T Q S R C R T S P Q D R Q R T S 14. The diagram below shows pairing of normal and mutated chromosomes during meiosis. What are the mutations that occur on the pairs of chromosomes I,II and III ? I II III A Deletion Duplication Translocation B Inversion Deletion Duplication C Duplication Deletion Translocation D Translocation Duplication Inversion 15. A type of gene mutation is as follows: mRNA - AAA UGG GUG UCU Amino acid lys trp val ser ↓ mutation mRNA - AAA UGG GAG UCU Amino acid lys trp glu ser The mutation results in A haemophilia B cystic fibrosis C sickle cell anaemia D thalassaemia major 16. In a plant species, a trisomic plant has 29 chromosomes and a monosomic plant has 27 chromosomes. How many chromosomes does a triplod plant have? A 28 B 42 C 81 D 87 17. A mutation involving the changing of one pair of nucleotide with another pair in a DNA molecule is called A substitution B insertion C deletion D inversion 18 A polyploidy condition resulting from the multiplication of a complete set of chromosomes from the same species is known as A trisomy B tetrasomy C allopolyploidy D autopolyploidy 19 Which one is the condition of euploidy? A 3n B 2n + 1 C monosomy D Turner syndrome 20 The sequence of a segment of DNA before and after mutation is shown in the table below. Before mutation CAT TAG GAT ACT Mutation 1 ATT AGG ATA CT Mutation 2 GCA TTA GGA TAC T What are the types of mutations 1 and 2? Mutation 1 Mutation 2 A Deletion Insertion B Deletion Substitution C Substitution Insertion D Substitution Deletion Structured Questions: 4/2005 During the formation of gametes, the failure of sister chromatids or a pair of homologous chromosomes to separate causes a mutation which changes the number of chromosomes. (a) Name the above phenomenon. ………………………………………………………………………………………………………………… [1 mark] (b) State the type of the above chromosomal mutation. ………………………………………………………………………………………………………………… [1 mark] (c) The diagram below shows the stage of meiosis during the formation of gametes which involve a pair of chromosome P and a pair of chromosome Q. Show the arrangement of chromosomes in the diagram below if the process in (a) occurs involving the pair of chromosome P during meiosis I. (d) What is the number of chromosome P if gametes S and T are fertilized by normal gametes? Gamete S …………………………………………………………………………………………………… Gamete T …………………………………………………………………………………………………… [2 marks] Essay Questions: 8/2006 (b) Describe the mutations that occur in DNA and chromosomes.